ID: 938248710

View in Genome Browser
Species Human (GRCh38)
Location 2:129797686-129797708
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938248696_938248710 23 Left 938248696 2:129797640-129797662 CCAGGGCCCAGCCAGAATTCAGG No data
Right 938248710 2:129797686-129797708 GGATAGGGCCACAGAGGCAGAGG No data
938248701_938248710 16 Left 938248701 2:129797647-129797669 CCAGCCAGAATTCAGGAGGGACA No data
Right 938248710 2:129797686-129797708 GGATAGGGCCACAGAGGCAGAGG No data
938248700_938248710 17 Left 938248700 2:129797646-129797668 CCCAGCCAGAATTCAGGAGGGAC No data
Right 938248710 2:129797686-129797708 GGATAGGGCCACAGAGGCAGAGG No data
938248702_938248710 12 Left 938248702 2:129797651-129797673 CCAGAATTCAGGAGGGACACAGC No data
Right 938248710 2:129797686-129797708 GGATAGGGCCACAGAGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type