ID: 938248711

View in Genome Browser
Species Human (GRCh38)
Location 2:129797693-129797715
Sequence GCCACAGAGGCAGAGGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938248701_938248711 23 Left 938248701 2:129797647-129797669 CCAGCCAGAATTCAGGAGGGACA No data
Right 938248711 2:129797693-129797715 GCCACAGAGGCAGAGGATGATGG No data
938248700_938248711 24 Left 938248700 2:129797646-129797668 CCCAGCCAGAATTCAGGAGGGAC No data
Right 938248711 2:129797693-129797715 GCCACAGAGGCAGAGGATGATGG No data
938248702_938248711 19 Left 938248702 2:129797651-129797673 CCAGAATTCAGGAGGGACACAGC No data
Right 938248711 2:129797693-129797715 GCCACAGAGGCAGAGGATGATGG No data
938248696_938248711 30 Left 938248696 2:129797640-129797662 CCAGGGCCCAGCCAGAATTCAGG No data
Right 938248711 2:129797693-129797715 GCCACAGAGGCAGAGGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938248711 Original CRISPR GCCACAGAGGCAGAGGATGA TGG Intergenic
No off target data available for this crispr