ID: 938248713

View in Genome Browser
Species Human (GRCh38)
Location 2:129797694-129797716
Sequence CCACAGAGGCAGAGGATGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938248701_938248713 24 Left 938248701 2:129797647-129797669 CCAGCCAGAATTCAGGAGGGACA No data
Right 938248713 2:129797694-129797716 CCACAGAGGCAGAGGATGATGGG No data
938248700_938248713 25 Left 938248700 2:129797646-129797668 CCCAGCCAGAATTCAGGAGGGAC No data
Right 938248713 2:129797694-129797716 CCACAGAGGCAGAGGATGATGGG No data
938248702_938248713 20 Left 938248702 2:129797651-129797673 CCAGAATTCAGGAGGGACACAGC No data
Right 938248713 2:129797694-129797716 CCACAGAGGCAGAGGATGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938248713 Original CRISPR CCACAGAGGCAGAGGATGAT GGG Intergenic