ID: 938248714

View in Genome Browser
Species Human (GRCh38)
Location 2:129797702-129797724
Sequence GCAGAGGATGATGGGTTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938248702_938248714 28 Left 938248702 2:129797651-129797673 CCAGAATTCAGGAGGGACACAGC No data
Right 938248714 2:129797702-129797724 GCAGAGGATGATGGGTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938248714 Original CRISPR GCAGAGGATGATGGGTTCTG AGG Intergenic