ID: 938248715

View in Genome Browser
Species Human (GRCh38)
Location 2:129797703-129797725
Sequence CAGAGGATGATGGGTTCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938248702_938248715 29 Left 938248702 2:129797651-129797673 CCAGAATTCAGGAGGGACACAGC No data
Right 938248715 2:129797703-129797725 CAGAGGATGATGGGTTCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938248715 Original CRISPR CAGAGGATGATGGGTTCTGA GGG Intergenic