ID: 938249898

View in Genome Browser
Species Human (GRCh38)
Location 2:129806508-129806530
Sequence GTGGGGAAGCTGAAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938249898_938249901 -7 Left 938249898 2:129806508-129806530 CCAGCCTCCTTCAGCTTCCCCAC No data
Right 938249901 2:129806524-129806546 TCCCCACCCTGCATTCCAGAAGG No data
938249898_938249908 16 Left 938249898 2:129806508-129806530 CCAGCCTCCTTCAGCTTCCCCAC No data
Right 938249908 2:129806547-129806569 TTTCTCAACCCCATGCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938249898 Original CRISPR GTGGGGAAGCTGAAGGAGGC TGG (reversed) Intergenic
No off target data available for this crispr