ID: 938249901

View in Genome Browser
Species Human (GRCh38)
Location 2:129806524-129806546
Sequence TCCCCACCCTGCATTCCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938249898_938249901 -7 Left 938249898 2:129806508-129806530 CCAGCCTCCTTCAGCTTCCCCAC No data
Right 938249901 2:129806524-129806546 TCCCCACCCTGCATTCCAGAAGG No data
938249894_938249901 7 Left 938249894 2:129806494-129806516 CCGGATTCCAAACCCCAGCCTCC No data
Right 938249901 2:129806524-129806546 TCCCCACCCTGCATTCCAGAAGG No data
938249893_938249901 20 Left 938249893 2:129806481-129806503 CCTGGGACTCAGACCGGATTCCA No data
Right 938249901 2:129806524-129806546 TCCCCACCCTGCATTCCAGAAGG No data
938249897_938249901 -6 Left 938249897 2:129806507-129806529 CCCAGCCTCCTTCAGCTTCCCCA No data
Right 938249901 2:129806524-129806546 TCCCCACCCTGCATTCCAGAAGG No data
938249896_938249901 -5 Left 938249896 2:129806506-129806528 CCCCAGCCTCCTTCAGCTTCCCC No data
Right 938249901 2:129806524-129806546 TCCCCACCCTGCATTCCAGAAGG No data
938249895_938249901 0 Left 938249895 2:129806501-129806523 CCAAACCCCAGCCTCCTTCAGCT No data
Right 938249901 2:129806524-129806546 TCCCCACCCTGCATTCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938249901 Original CRISPR TCCCCACCCTGCATTCCAGA AGG Intergenic
No off target data available for this crispr