ID: 938249908

View in Genome Browser
Species Human (GRCh38)
Location 2:129806547-129806569
Sequence TTTCTCAACCCCATGCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938249898_938249908 16 Left 938249898 2:129806508-129806530 CCAGCCTCCTTCAGCTTCCCCAC No data
Right 938249908 2:129806547-129806569 TTTCTCAACCCCATGCAAGAAGG No data
938249896_938249908 18 Left 938249896 2:129806506-129806528 CCCCAGCCTCCTTCAGCTTCCCC No data
Right 938249908 2:129806547-129806569 TTTCTCAACCCCATGCAAGAAGG No data
938249895_938249908 23 Left 938249895 2:129806501-129806523 CCAAACCCCAGCCTCCTTCAGCT No data
Right 938249908 2:129806547-129806569 TTTCTCAACCCCATGCAAGAAGG No data
938249902_938249908 -1 Left 938249902 2:129806525-129806547 CCCCACCCTGCATTCCAGAAGGT No data
Right 938249908 2:129806547-129806569 TTTCTCAACCCCATGCAAGAAGG No data
938249899_938249908 12 Left 938249899 2:129806512-129806534 CCTCCTTCAGCTTCCCCACCCTG No data
Right 938249908 2:129806547-129806569 TTTCTCAACCCCATGCAAGAAGG No data
938249904_938249908 -3 Left 938249904 2:129806527-129806549 CCACCCTGCATTCCAGAAGGTTT No data
Right 938249908 2:129806547-129806569 TTTCTCAACCCCATGCAAGAAGG No data
938249903_938249908 -2 Left 938249903 2:129806526-129806548 CCCACCCTGCATTCCAGAAGGTT No data
Right 938249908 2:129806547-129806569 TTTCTCAACCCCATGCAAGAAGG No data
938249906_938249908 -7 Left 938249906 2:129806531-129806553 CCTGCATTCCAGAAGGTTTCTCA No data
Right 938249908 2:129806547-129806569 TTTCTCAACCCCATGCAAGAAGG No data
938249894_938249908 30 Left 938249894 2:129806494-129806516 CCGGATTCCAAACCCCAGCCTCC No data
Right 938249908 2:129806547-129806569 TTTCTCAACCCCATGCAAGAAGG No data
938249897_938249908 17 Left 938249897 2:129806507-129806529 CCCAGCCTCCTTCAGCTTCCCCA No data
Right 938249908 2:129806547-129806569 TTTCTCAACCCCATGCAAGAAGG No data
938249900_938249908 9 Left 938249900 2:129806515-129806537 CCTTCAGCTTCCCCACCCTGCAT No data
Right 938249908 2:129806547-129806569 TTTCTCAACCCCATGCAAGAAGG No data
938249905_938249908 -6 Left 938249905 2:129806530-129806552 CCCTGCATTCCAGAAGGTTTCTC No data
Right 938249908 2:129806547-129806569 TTTCTCAACCCCATGCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938249908 Original CRISPR TTTCTCAACCCCATGCAAGA AGG Intergenic
No off target data available for this crispr