ID: 938251054

View in Genome Browser
Species Human (GRCh38)
Location 2:129816027-129816049
Sequence GTTTTTAAGGGGAATATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938251047_938251054 -2 Left 938251047 2:129816006-129816028 CCCAAGAAGTTCTGGGCTAGGGT No data
Right 938251054 2:129816027-129816049 GTTTTTAAGGGGAATATGGAGGG No data
938251042_938251054 5 Left 938251042 2:129815999-129816021 CCATCTCCCCAAGAAGTTCTGGG No data
Right 938251054 2:129816027-129816049 GTTTTTAAGGGGAATATGGAGGG No data
938251040_938251054 13 Left 938251040 2:129815991-129816013 CCTTAAATCCATCTCCCCAAGAA No data
Right 938251054 2:129816027-129816049 GTTTTTAAGGGGAATATGGAGGG No data
938251045_938251054 -1 Left 938251045 2:129816005-129816027 CCCCAAGAAGTTCTGGGCTAGGG No data
Right 938251054 2:129816027-129816049 GTTTTTAAGGGGAATATGGAGGG No data
938251039_938251054 14 Left 938251039 2:129815990-129816012 CCCTTAAATCCATCTCCCCAAGA No data
Right 938251054 2:129816027-129816049 GTTTTTAAGGGGAATATGGAGGG No data
938251048_938251054 -3 Left 938251048 2:129816007-129816029 CCAAGAAGTTCTGGGCTAGGGTT No data
Right 938251054 2:129816027-129816049 GTTTTTAAGGGGAATATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938251054 Original CRISPR GTTTTTAAGGGGAATATGGA GGG Intergenic
No off target data available for this crispr