ID: 938253272

View in Genome Browser
Species Human (GRCh38)
Location 2:129833044-129833066
Sequence CATCAGAGGGAGACTGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938253272_938253281 13 Left 938253272 2:129833044-129833066 CCCCCCACAGTCTCCCTCTGATG No data
Right 938253281 2:129833080-129833102 GGACTGTACTGCCGCGATCTCGG 0: 13
1: 202
2: 952
3: 1781
4: 37907
938253272_938253279 -8 Left 938253272 2:129833044-129833066 CCCCCCACAGTCTCCCTCTGATG No data
Right 938253279 2:129833059-129833081 CTCTGATGTCGAGCCGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938253272 Original CRISPR CATCAGAGGGAGACTGTGGG GGG (reversed) Intergenic
No off target data available for this crispr