ID: 938255358

View in Genome Browser
Species Human (GRCh38)
Location 2:129855168-129855190
Sequence ACCAGGGATGTGTGCACACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938255358_938255363 16 Left 938255358 2:129855168-129855190 CCTTGTGTGCACACATCCCTGGT No data
Right 938255363 2:129855207-129855229 ATTAAGGACACCAGTCATATTGG No data
938255358_938255361 0 Left 938255358 2:129855168-129855190 CCTTGTGTGCACACATCCCTGGT No data
Right 938255361 2:129855191-129855213 GTCTGTTCCTCTTCTTATTAAGG No data
938255358_938255364 22 Left 938255358 2:129855168-129855190 CCTTGTGTGCACACATCCCTGGT No data
Right 938255364 2:129855213-129855235 GACACCAGTCATATTGGATTAGG 0: 209
1: 805
2: 1640
3: 1986
4: 1974
938255358_938255365 23 Left 938255358 2:129855168-129855190 CCTTGTGTGCACACATCCCTGGT No data
Right 938255365 2:129855214-129855236 ACACCAGTCATATTGGATTAGGG 0: 235
1: 883
2: 1637
3: 2139
4: 1994

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938255358 Original CRISPR ACCAGGGATGTGTGCACACA AGG (reversed) Intergenic
No off target data available for this crispr