ID: 938260609

View in Genome Browser
Species Human (GRCh38)
Location 2:129892661-129892683
Sequence CTCCTGTGACAAAGGGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938260609_938260617 18 Left 938260609 2:129892661-129892683 CCTTGGCCCCTTTGTCACAGGAG No data
Right 938260617 2:129892702-129892724 TTCATGTGACTAATGCGTGAAGG No data
938260609_938260615 -7 Left 938260609 2:129892661-129892683 CCTTGGCCCCTTTGTCACAGGAG No data
Right 938260615 2:129892677-129892699 ACAGGAGCTTGGCAGGTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938260609 Original CRISPR CTCCTGTGACAAAGGGGCCA AGG (reversed) Intergenic
No off target data available for this crispr