ID: 938261128

View in Genome Browser
Species Human (GRCh38)
Location 2:129895838-129895860
Sequence CGATCACTGGATGCTGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938261128_938261146 22 Left 938261128 2:129895838-129895860 CCCACCACAGCATCCAGTGATCG No data
Right 938261146 2:129895883-129895905 GGGGAGGACAGGGCACACAGAGG No data
938261128_938261148 30 Left 938261128 2:129895838-129895860 CCCACCACAGCATCCAGTGATCG No data
Right 938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG No data
938261128_938261135 -10 Left 938261128 2:129895838-129895860 CCCACCACAGCATCCAGTGATCG No data
Right 938261135 2:129895851-129895873 CCAGTGATCGGCCATGGCATGGG No data
938261128_938261142 6 Left 938261128 2:129895838-129895860 CCCACCACAGCATCCAGTGATCG No data
Right 938261142 2:129895867-129895889 GCATGGGGGCCTGTCTGGGGAGG No data
938261128_938261144 12 Left 938261128 2:129895838-129895860 CCCACCACAGCATCCAGTGATCG No data
Right 938261144 2:129895873-129895895 GGGCCTGTCTGGGGAGGACAGGG No data
938261128_938261136 -9 Left 938261128 2:129895838-129895860 CCCACCACAGCATCCAGTGATCG No data
Right 938261136 2:129895852-129895874 CAGTGATCGGCCATGGCATGGGG No data
938261128_938261137 -8 Left 938261128 2:129895838-129895860 CCCACCACAGCATCCAGTGATCG No data
Right 938261137 2:129895853-129895875 AGTGATCGGCCATGGCATGGGGG No data
938261128_938261139 1 Left 938261128 2:129895838-129895860 CCCACCACAGCATCCAGTGATCG No data
Right 938261139 2:129895862-129895884 CCATGGCATGGGGGCCTGTCTGG No data
938261128_938261141 3 Left 938261128 2:129895838-129895860 CCCACCACAGCATCCAGTGATCG No data
Right 938261141 2:129895864-129895886 ATGGCATGGGGGCCTGTCTGGGG No data
938261128_938261140 2 Left 938261128 2:129895838-129895860 CCCACCACAGCATCCAGTGATCG No data
Right 938261140 2:129895863-129895885 CATGGCATGGGGGCCTGTCTGGG No data
938261128_938261147 26 Left 938261128 2:129895838-129895860 CCCACCACAGCATCCAGTGATCG No data
Right 938261147 2:129895887-129895909 AGGACAGGGCACACAGAGGAAGG No data
938261128_938261143 11 Left 938261128 2:129895838-129895860 CCCACCACAGCATCCAGTGATCG No data
Right 938261143 2:129895872-129895894 GGGGCCTGTCTGGGGAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938261128 Original CRISPR CGATCACTGGATGCTGTGGT GGG (reversed) Intergenic
No off target data available for this crispr