ID: 938261129

View in Genome Browser
Species Human (GRCh38)
Location 2:129895839-129895861
Sequence CCGATCACTGGATGCTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938261129_938261141 2 Left 938261129 2:129895839-129895861 CCACCACAGCATCCAGTGATCGG No data
Right 938261141 2:129895864-129895886 ATGGCATGGGGGCCTGTCTGGGG No data
938261129_938261147 25 Left 938261129 2:129895839-129895861 CCACCACAGCATCCAGTGATCGG No data
Right 938261147 2:129895887-129895909 AGGACAGGGCACACAGAGGAAGG No data
938261129_938261143 10 Left 938261129 2:129895839-129895861 CCACCACAGCATCCAGTGATCGG No data
Right 938261143 2:129895872-129895894 GGGGCCTGTCTGGGGAGGACAGG No data
938261129_938261140 1 Left 938261129 2:129895839-129895861 CCACCACAGCATCCAGTGATCGG No data
Right 938261140 2:129895863-129895885 CATGGCATGGGGGCCTGTCTGGG No data
938261129_938261146 21 Left 938261129 2:129895839-129895861 CCACCACAGCATCCAGTGATCGG No data
Right 938261146 2:129895883-129895905 GGGGAGGACAGGGCACACAGAGG No data
938261129_938261136 -10 Left 938261129 2:129895839-129895861 CCACCACAGCATCCAGTGATCGG No data
Right 938261136 2:129895852-129895874 CAGTGATCGGCCATGGCATGGGG No data
938261129_938261142 5 Left 938261129 2:129895839-129895861 CCACCACAGCATCCAGTGATCGG No data
Right 938261142 2:129895867-129895889 GCATGGGGGCCTGTCTGGGGAGG No data
938261129_938261148 29 Left 938261129 2:129895839-129895861 CCACCACAGCATCCAGTGATCGG No data
Right 938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG No data
938261129_938261139 0 Left 938261129 2:129895839-129895861 CCACCACAGCATCCAGTGATCGG No data
Right 938261139 2:129895862-129895884 CCATGGCATGGGGGCCTGTCTGG No data
938261129_938261144 11 Left 938261129 2:129895839-129895861 CCACCACAGCATCCAGTGATCGG No data
Right 938261144 2:129895873-129895895 GGGCCTGTCTGGGGAGGACAGGG No data
938261129_938261137 -9 Left 938261129 2:129895839-129895861 CCACCACAGCATCCAGTGATCGG No data
Right 938261137 2:129895853-129895875 AGTGATCGGCCATGGCATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938261129 Original CRISPR CCGATCACTGGATGCTGTGG TGG (reversed) Intergenic
No off target data available for this crispr