ID: 938261131

View in Genome Browser
Species Human (GRCh38)
Location 2:129895842-129895864
Sequence TGGCCGATCACTGGATGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938261131_938261140 -2 Left 938261131 2:129895842-129895864 CCACAGCATCCAGTGATCGGCCA No data
Right 938261140 2:129895863-129895885 CATGGCATGGGGGCCTGTCTGGG No data
938261131_938261143 7 Left 938261131 2:129895842-129895864 CCACAGCATCCAGTGATCGGCCA No data
Right 938261143 2:129895872-129895894 GGGGCCTGTCTGGGGAGGACAGG No data
938261131_938261139 -3 Left 938261131 2:129895842-129895864 CCACAGCATCCAGTGATCGGCCA No data
Right 938261139 2:129895862-129895884 CCATGGCATGGGGGCCTGTCTGG No data
938261131_938261147 22 Left 938261131 2:129895842-129895864 CCACAGCATCCAGTGATCGGCCA No data
Right 938261147 2:129895887-129895909 AGGACAGGGCACACAGAGGAAGG No data
938261131_938261149 30 Left 938261131 2:129895842-129895864 CCACAGCATCCAGTGATCGGCCA No data
Right 938261149 2:129895895-129895917 GCACACAGAGGAAGGAAGGATGG No data
938261131_938261146 18 Left 938261131 2:129895842-129895864 CCACAGCATCCAGTGATCGGCCA No data
Right 938261146 2:129895883-129895905 GGGGAGGACAGGGCACACAGAGG No data
938261131_938261148 26 Left 938261131 2:129895842-129895864 CCACAGCATCCAGTGATCGGCCA No data
Right 938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG No data
938261131_938261142 2 Left 938261131 2:129895842-129895864 CCACAGCATCCAGTGATCGGCCA No data
Right 938261142 2:129895867-129895889 GCATGGGGGCCTGTCTGGGGAGG No data
938261131_938261144 8 Left 938261131 2:129895842-129895864 CCACAGCATCCAGTGATCGGCCA No data
Right 938261144 2:129895873-129895895 GGGCCTGTCTGGGGAGGACAGGG No data
938261131_938261141 -1 Left 938261131 2:129895842-129895864 CCACAGCATCCAGTGATCGGCCA No data
Right 938261141 2:129895864-129895886 ATGGCATGGGGGCCTGTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938261131 Original CRISPR TGGCCGATCACTGGATGCTG TGG (reversed) Intergenic
No off target data available for this crispr