ID: 938261134

View in Genome Browser
Species Human (GRCh38)
Location 2:129895851-129895873
Sequence CCCATGCCATGGCCGATCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938261134_938261143 -2 Left 938261134 2:129895851-129895873 CCAGTGATCGGCCATGGCATGGG No data
Right 938261143 2:129895872-129895894 GGGGCCTGTCTGGGGAGGACAGG No data
938261134_938261144 -1 Left 938261134 2:129895851-129895873 CCAGTGATCGGCCATGGCATGGG No data
Right 938261144 2:129895873-129895895 GGGCCTGTCTGGGGAGGACAGGG No data
938261134_938261142 -7 Left 938261134 2:129895851-129895873 CCAGTGATCGGCCATGGCATGGG No data
Right 938261142 2:129895867-129895889 GCATGGGGGCCTGTCTGGGGAGG No data
938261134_938261149 21 Left 938261134 2:129895851-129895873 CCAGTGATCGGCCATGGCATGGG No data
Right 938261149 2:129895895-129895917 GCACACAGAGGAAGGAAGGATGG No data
938261134_938261151 29 Left 938261134 2:129895851-129895873 CCAGTGATCGGCCATGGCATGGG No data
Right 938261151 2:129895903-129895925 AGGAAGGAAGGATGGGTCTCAGG No data
938261134_938261150 22 Left 938261134 2:129895851-129895873 CCAGTGATCGGCCATGGCATGGG No data
Right 938261150 2:129895896-129895918 CACACAGAGGAAGGAAGGATGGG No data
938261134_938261148 17 Left 938261134 2:129895851-129895873 CCAGTGATCGGCCATGGCATGGG No data
Right 938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG No data
938261134_938261141 -10 Left 938261134 2:129895851-129895873 CCAGTGATCGGCCATGGCATGGG No data
Right 938261141 2:129895864-129895886 ATGGCATGGGGGCCTGTCTGGGG No data
938261134_938261147 13 Left 938261134 2:129895851-129895873 CCAGTGATCGGCCATGGCATGGG No data
Right 938261147 2:129895887-129895909 AGGACAGGGCACACAGAGGAAGG No data
938261134_938261146 9 Left 938261134 2:129895851-129895873 CCAGTGATCGGCCATGGCATGGG No data
Right 938261146 2:129895883-129895905 GGGGAGGACAGGGCACACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938261134 Original CRISPR CCCATGCCATGGCCGATCAC TGG (reversed) Intergenic
No off target data available for this crispr