ID: 938261138

View in Genome Browser
Species Human (GRCh38)
Location 2:129895862-129895884
Sequence CCAGACAGGCCCCCATGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938261138_938261150 11 Left 938261138 2:129895862-129895884 CCATGGCATGGGGGCCTGTCTGG No data
Right 938261150 2:129895896-129895918 CACACAGAGGAAGGAAGGATGGG No data
938261138_938261148 6 Left 938261138 2:129895862-129895884 CCATGGCATGGGGGCCTGTCTGG No data
Right 938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG No data
938261138_938261152 21 Left 938261138 2:129895862-129895884 CCATGGCATGGGGGCCTGTCTGG No data
Right 938261152 2:129895906-129895928 AAGGAAGGATGGGTCTCAGGTGG No data
938261138_938261147 2 Left 938261138 2:129895862-129895884 CCATGGCATGGGGGCCTGTCTGG No data
Right 938261147 2:129895887-129895909 AGGACAGGGCACACAGAGGAAGG No data
938261138_938261149 10 Left 938261138 2:129895862-129895884 CCATGGCATGGGGGCCTGTCTGG No data
Right 938261149 2:129895895-129895917 GCACACAGAGGAAGGAAGGATGG No data
938261138_938261151 18 Left 938261138 2:129895862-129895884 CCATGGCATGGGGGCCTGTCTGG No data
Right 938261151 2:129895903-129895925 AGGAAGGAAGGATGGGTCTCAGG No data
938261138_938261153 22 Left 938261138 2:129895862-129895884 CCATGGCATGGGGGCCTGTCTGG No data
Right 938261153 2:129895907-129895929 AGGAAGGATGGGTCTCAGGTGGG No data
938261138_938261146 -2 Left 938261138 2:129895862-129895884 CCATGGCATGGGGGCCTGTCTGG No data
Right 938261146 2:129895883-129895905 GGGGAGGACAGGGCACACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938261138 Original CRISPR CCAGACAGGCCCCCATGCCA TGG (reversed) Intergenic
No off target data available for this crispr