ID: 938261145

View in Genome Browser
Species Human (GRCh38)
Location 2:129895876-129895898
Sequence GTGCCCTGTCCTCCCCAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938261145_938261156 26 Left 938261145 2:129895876-129895898 CCTGTCTGGGGAGGACAGGGCAC No data
Right 938261156 2:129895925-129895947 GTGGGCTGACACCTGGGAAAAGG No data
938261145_938261154 19 Left 938261145 2:129895876-129895898 CCTGTCTGGGGAGGACAGGGCAC No data
Right 938261154 2:129895918-129895940 GTCTCAGGTGGGCTGACACCTGG No data
938261145_938261151 4 Left 938261145 2:129895876-129895898 CCTGTCTGGGGAGGACAGGGCAC No data
Right 938261151 2:129895903-129895925 AGGAAGGAAGGATGGGTCTCAGG No data
938261145_938261153 8 Left 938261145 2:129895876-129895898 CCTGTCTGGGGAGGACAGGGCAC No data
Right 938261153 2:129895907-129895929 AGGAAGGATGGGTCTCAGGTGGG No data
938261145_938261149 -4 Left 938261145 2:129895876-129895898 CCTGTCTGGGGAGGACAGGGCAC No data
Right 938261149 2:129895895-129895917 GCACACAGAGGAAGGAAGGATGG No data
938261145_938261158 30 Left 938261145 2:129895876-129895898 CCTGTCTGGGGAGGACAGGGCAC No data
Right 938261158 2:129895929-129895951 GCTGACACCTGGGAAAAGGGTGG No data
938261145_938261148 -8 Left 938261145 2:129895876-129895898 CCTGTCTGGGGAGGACAGGGCAC No data
Right 938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG No data
938261145_938261152 7 Left 938261145 2:129895876-129895898 CCTGTCTGGGGAGGACAGGGCAC No data
Right 938261152 2:129895906-129895928 AAGGAAGGATGGGTCTCAGGTGG No data
938261145_938261150 -3 Left 938261145 2:129895876-129895898 CCTGTCTGGGGAGGACAGGGCAC No data
Right 938261150 2:129895896-129895918 CACACAGAGGAAGGAAGGATGGG No data
938261145_938261155 20 Left 938261145 2:129895876-129895898 CCTGTCTGGGGAGGACAGGGCAC No data
Right 938261155 2:129895919-129895941 TCTCAGGTGGGCTGACACCTGGG No data
938261145_938261157 27 Left 938261145 2:129895876-129895898 CCTGTCTGGGGAGGACAGGGCAC No data
Right 938261157 2:129895926-129895948 TGGGCTGACACCTGGGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938261145 Original CRISPR GTGCCCTGTCCTCCCCAGAC AGG (reversed) Intergenic
No off target data available for this crispr