ID: 938261148

View in Genome Browser
Species Human (GRCh38)
Location 2:129895891-129895913
Sequence CAGGGCACACAGAGGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938261131_938261148 26 Left 938261131 2:129895842-129895864 CCACAGCATCCAGTGATCGGCCA No data
Right 938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG No data
938261134_938261148 17 Left 938261134 2:129895851-129895873 CCAGTGATCGGCCATGGCATGGG No data
Right 938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG No data
938261129_938261148 29 Left 938261129 2:129895839-129895861 CCACCACAGCATCCAGTGATCGG No data
Right 938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG No data
938261128_938261148 30 Left 938261128 2:129895838-129895860 CCCACCACAGCATCCAGTGATCG No data
Right 938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG No data
938261138_938261148 6 Left 938261138 2:129895862-129895884 CCATGGCATGGGGGCCTGTCTGG No data
Right 938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG No data
938261145_938261148 -8 Left 938261145 2:129895876-129895898 CCTGTCTGGGGAGGACAGGGCAC No data
Right 938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938261148 Original CRISPR CAGGGCACACAGAGGAAGGA AGG Intergenic
No off target data available for this crispr