ID: 938262112

View in Genome Browser
Species Human (GRCh38)
Location 2:129903665-129903687
Sequence AAAGCCCAGGTGCCACAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938262106_938262112 3 Left 938262106 2:129903639-129903661 CCTGCTTCCAGCAGAAAACCACC No data
Right 938262112 2:129903665-129903687 AAAGCCCAGGTGCCACAAGCTGG No data
938262104_938262112 20 Left 938262104 2:129903622-129903644 CCTGGTGACCTGTGGGACCTGCT No data
Right 938262112 2:129903665-129903687 AAAGCCCAGGTGCCACAAGCTGG No data
938262105_938262112 12 Left 938262105 2:129903630-129903652 CCTGTGGGACCTGCTTCCAGCAG No data
Right 938262112 2:129903665-129903687 AAAGCCCAGGTGCCACAAGCTGG No data
938262107_938262112 -4 Left 938262107 2:129903646-129903668 CCAGCAGAAAACCACCCACAAAG No data
Right 938262112 2:129903665-129903687 AAAGCCCAGGTGCCACAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938262112 Original CRISPR AAAGCCCAGGTGCCACAAGC TGG Intergenic
No off target data available for this crispr