ID: 938263002

View in Genome Browser
Species Human (GRCh38)
Location 2:129908642-129908664
Sequence GACCACGAAGGACACCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938262996_938263002 12 Left 938262996 2:129908607-129908629 CCTGAAGAGGGTCAGGGTCAGAG No data
Right 938263002 2:129908642-129908664 GACCACGAAGGACACCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938263002 Original CRISPR GACCACGAAGGACACCTGGG AGG Intergenic
No off target data available for this crispr