ID: 938263170

View in Genome Browser
Species Human (GRCh38)
Location 2:129909565-129909587
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938263170_938263191 16 Left 938263170 2:129909565-129909587 CCCCTCCCCACTGTCCACCCCCA No data
Right 938263191 2:129909604-129909626 CCAAAGCCCACTCCACTGTGGGG No data
938263170_938263194 23 Left 938263170 2:129909565-129909587 CCCCTCCCCACTGTCCACCCCCA No data
Right 938263194 2:129909611-129909633 CCACTCCACTGTGGGGTTGCAGG No data
938263170_938263187 14 Left 938263170 2:129909565-129909587 CCCCTCCCCACTGTCCACCCCCA No data
Right 938263187 2:129909602-129909624 TCCCAAAGCCCACTCCACTGTGG No data
938263170_938263189 15 Left 938263170 2:129909565-129909587 CCCCTCCCCACTGTCCACCCCCA No data
Right 938263189 2:129909603-129909625 CCCAAAGCCCACTCCACTGTGGG No data
938263170_938263196 28 Left 938263170 2:129909565-129909587 CCCCTCCCCACTGTCCACCCCCA No data
Right 938263196 2:129909616-129909638 CCACTGTGGGGTTGCAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938263170 Original CRISPR TGGGGGTGGACAGTGGGGAG GGG (reversed) Intergenic
No off target data available for this crispr