ID: 938263173

View in Genome Browser
Species Human (GRCh38)
Location 2:129909570-129909592
Sequence TGGGGTGGGGGTGGACAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938263173_938263194 18 Left 938263173 2:129909570-129909592 CCCCACTGTCCACCCCCACCCCA No data
Right 938263194 2:129909611-129909633 CCACTCCACTGTGGGGTTGCAGG No data
938263173_938263197 27 Left 938263173 2:129909570-129909592 CCCCACTGTCCACCCCCACCCCA No data
Right 938263197 2:129909620-129909642 TGTGGGGTTGCAGGACAGGAAGG No data
938263173_938263189 10 Left 938263173 2:129909570-129909592 CCCCACTGTCCACCCCCACCCCA No data
Right 938263189 2:129909603-129909625 CCCAAAGCCCACTCCACTGTGGG No data
938263173_938263196 23 Left 938263173 2:129909570-129909592 CCCCACTGTCCACCCCCACCCCA No data
Right 938263196 2:129909616-129909638 CCACTGTGGGGTTGCAGGACAGG No data
938263173_938263198 28 Left 938263173 2:129909570-129909592 CCCCACTGTCCACCCCCACCCCA No data
Right 938263198 2:129909621-129909643 GTGGGGTTGCAGGACAGGAAGGG No data
938263173_938263191 11 Left 938263173 2:129909570-129909592 CCCCACTGTCCACCCCCACCCCA No data
Right 938263191 2:129909604-129909626 CCAAAGCCCACTCCACTGTGGGG No data
938263173_938263187 9 Left 938263173 2:129909570-129909592 CCCCACTGTCCACCCCCACCCCA No data
Right 938263187 2:129909602-129909624 TCCCAAAGCCCACTCCACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938263173 Original CRISPR TGGGGTGGGGGTGGACAGTG GGG (reversed) Intergenic
No off target data available for this crispr