ID: 938263174

View in Genome Browser
Species Human (GRCh38)
Location 2:129909571-129909593
Sequence ATGGGGTGGGGGTGGACAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938263174_938263194 17 Left 938263174 2:129909571-129909593 CCCACTGTCCACCCCCACCCCAT No data
Right 938263194 2:129909611-129909633 CCACTCCACTGTGGGGTTGCAGG No data
938263174_938263187 8 Left 938263174 2:129909571-129909593 CCCACTGTCCACCCCCACCCCAT No data
Right 938263187 2:129909602-129909624 TCCCAAAGCCCACTCCACTGTGG No data
938263174_938263191 10 Left 938263174 2:129909571-129909593 CCCACTGTCCACCCCCACCCCAT No data
Right 938263191 2:129909604-129909626 CCAAAGCCCACTCCACTGTGGGG No data
938263174_938263198 27 Left 938263174 2:129909571-129909593 CCCACTGTCCACCCCCACCCCAT No data
Right 938263198 2:129909621-129909643 GTGGGGTTGCAGGACAGGAAGGG No data
938263174_938263189 9 Left 938263174 2:129909571-129909593 CCCACTGTCCACCCCCACCCCAT No data
Right 938263189 2:129909603-129909625 CCCAAAGCCCACTCCACTGTGGG No data
938263174_938263197 26 Left 938263174 2:129909571-129909593 CCCACTGTCCACCCCCACCCCAT No data
Right 938263197 2:129909620-129909642 TGTGGGGTTGCAGGACAGGAAGG No data
938263174_938263196 22 Left 938263174 2:129909571-129909593 CCCACTGTCCACCCCCACCCCAT No data
Right 938263196 2:129909616-129909638 CCACTGTGGGGTTGCAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938263174 Original CRISPR ATGGGGTGGGGGTGGACAGT GGG (reversed) Intergenic
No off target data available for this crispr