ID: 938263175

View in Genome Browser
Species Human (GRCh38)
Location 2:129909572-129909594
Sequence CATGGGGTGGGGGTGGACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938263175_938263197 25 Left 938263175 2:129909572-129909594 CCACTGTCCACCCCCACCCCATG No data
Right 938263197 2:129909620-129909642 TGTGGGGTTGCAGGACAGGAAGG No data
938263175_938263187 7 Left 938263175 2:129909572-129909594 CCACTGTCCACCCCCACCCCATG No data
Right 938263187 2:129909602-129909624 TCCCAAAGCCCACTCCACTGTGG No data
938263175_938263196 21 Left 938263175 2:129909572-129909594 CCACTGTCCACCCCCACCCCATG No data
Right 938263196 2:129909616-129909638 CCACTGTGGGGTTGCAGGACAGG No data
938263175_938263189 8 Left 938263175 2:129909572-129909594 CCACTGTCCACCCCCACCCCATG No data
Right 938263189 2:129909603-129909625 CCCAAAGCCCACTCCACTGTGGG No data
938263175_938263198 26 Left 938263175 2:129909572-129909594 CCACTGTCCACCCCCACCCCATG No data
Right 938263198 2:129909621-129909643 GTGGGGTTGCAGGACAGGAAGGG No data
938263175_938263191 9 Left 938263175 2:129909572-129909594 CCACTGTCCACCCCCACCCCATG No data
Right 938263191 2:129909604-129909626 CCAAAGCCCACTCCACTGTGGGG No data
938263175_938263194 16 Left 938263175 2:129909572-129909594 CCACTGTCCACCCCCACCCCATG No data
Right 938263194 2:129909611-129909633 CCACTCCACTGTGGGGTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938263175 Original CRISPR CATGGGGTGGGGGTGGACAG TGG (reversed) Intergenic
No off target data available for this crispr