ID: 938263181

View in Genome Browser
Species Human (GRCh38)
Location 2:129909584-129909606
Sequence TGGGAGGACCCTCATGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938263181_938263194 4 Left 938263181 2:129909584-129909606 CCCACCCCATGAGGGTCCTCCCA No data
Right 938263194 2:129909611-129909633 CCACTCCACTGTGGGGTTGCAGG No data
938263181_938263198 14 Left 938263181 2:129909584-129909606 CCCACCCCATGAGGGTCCTCCCA No data
Right 938263198 2:129909621-129909643 GTGGGGTTGCAGGACAGGAAGGG No data
938263181_938263187 -5 Left 938263181 2:129909584-129909606 CCCACCCCATGAGGGTCCTCCCA No data
Right 938263187 2:129909602-129909624 TCCCAAAGCCCACTCCACTGTGG No data
938263181_938263189 -4 Left 938263181 2:129909584-129909606 CCCACCCCATGAGGGTCCTCCCA No data
Right 938263189 2:129909603-129909625 CCCAAAGCCCACTCCACTGTGGG No data
938263181_938263200 27 Left 938263181 2:129909584-129909606 CCCACCCCATGAGGGTCCTCCCA No data
Right 938263200 2:129909634-129909656 ACAGGAAGGGTGAGAGATGGCGG No data
938263181_938263197 13 Left 938263181 2:129909584-129909606 CCCACCCCATGAGGGTCCTCCCA No data
Right 938263197 2:129909620-129909642 TGTGGGGTTGCAGGACAGGAAGG No data
938263181_938263196 9 Left 938263181 2:129909584-129909606 CCCACCCCATGAGGGTCCTCCCA No data
Right 938263196 2:129909616-129909638 CCACTGTGGGGTTGCAGGACAGG No data
938263181_938263199 24 Left 938263181 2:129909584-129909606 CCCACCCCATGAGGGTCCTCCCA No data
Right 938263199 2:129909631-129909653 AGGACAGGAAGGGTGAGAGATGG No data
938263181_938263191 -3 Left 938263181 2:129909584-129909606 CCCACCCCATGAGGGTCCTCCCA No data
Right 938263191 2:129909604-129909626 CCAAAGCCCACTCCACTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938263181 Original CRISPR TGGGAGGACCCTCATGGGGT GGG (reversed) Intergenic
No off target data available for this crispr