ID: 938263184

View in Genome Browser
Species Human (GRCh38)
Location 2:129909589-129909611
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938263184_938263199 19 Left 938263184 2:129909589-129909611 CCCATGAGGGTCCTCCCAAAGCC No data
Right 938263199 2:129909631-129909653 AGGACAGGAAGGGTGAGAGATGG No data
938263184_938263197 8 Left 938263184 2:129909589-129909611 CCCATGAGGGTCCTCCCAAAGCC No data
Right 938263197 2:129909620-129909642 TGTGGGGTTGCAGGACAGGAAGG No data
938263184_938263194 -1 Left 938263184 2:129909589-129909611 CCCATGAGGGTCCTCCCAAAGCC No data
Right 938263194 2:129909611-129909633 CCACTCCACTGTGGGGTTGCAGG No data
938263184_938263198 9 Left 938263184 2:129909589-129909611 CCCATGAGGGTCCTCCCAAAGCC No data
Right 938263198 2:129909621-129909643 GTGGGGTTGCAGGACAGGAAGGG No data
938263184_938263191 -8 Left 938263184 2:129909589-129909611 CCCATGAGGGTCCTCCCAAAGCC No data
Right 938263191 2:129909604-129909626 CCAAAGCCCACTCCACTGTGGGG No data
938263184_938263200 22 Left 938263184 2:129909589-129909611 CCCATGAGGGTCCTCCCAAAGCC No data
Right 938263200 2:129909634-129909656 ACAGGAAGGGTGAGAGATGGCGG No data
938263184_938263201 30 Left 938263184 2:129909589-129909611 CCCATGAGGGTCCTCCCAAAGCC No data
Right 938263201 2:129909642-129909664 GGTGAGAGATGGCGGAGAAGCGG No data
938263184_938263189 -9 Left 938263184 2:129909589-129909611 CCCATGAGGGTCCTCCCAAAGCC No data
Right 938263189 2:129909603-129909625 CCCAAAGCCCACTCCACTGTGGG No data
938263184_938263187 -10 Left 938263184 2:129909589-129909611 CCCATGAGGGTCCTCCCAAAGCC No data
Right 938263187 2:129909602-129909624 TCCCAAAGCCCACTCCACTGTGG No data
938263184_938263196 4 Left 938263184 2:129909589-129909611 CCCATGAGGGTCCTCCCAAAGCC No data
Right 938263196 2:129909616-129909638 CCACTGTGGGGTTGCAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938263184 Original CRISPR GGCTTTGGGAGGACCCTCAT GGG (reversed) Intergenic
No off target data available for this crispr