ID: 938263185

View in Genome Browser
Species Human (GRCh38)
Location 2:129909590-129909612
Sequence GGGCTTTGGGAGGACCCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938263185_938263194 -2 Left 938263185 2:129909590-129909612 CCATGAGGGTCCTCCCAAAGCCC No data
Right 938263194 2:129909611-129909633 CCACTCCACTGTGGGGTTGCAGG No data
938263185_938263191 -9 Left 938263185 2:129909590-129909612 CCATGAGGGTCCTCCCAAAGCCC No data
Right 938263191 2:129909604-129909626 CCAAAGCCCACTCCACTGTGGGG No data
938263185_938263200 21 Left 938263185 2:129909590-129909612 CCATGAGGGTCCTCCCAAAGCCC No data
Right 938263200 2:129909634-129909656 ACAGGAAGGGTGAGAGATGGCGG No data
938263185_938263196 3 Left 938263185 2:129909590-129909612 CCATGAGGGTCCTCCCAAAGCCC No data
Right 938263196 2:129909616-129909638 CCACTGTGGGGTTGCAGGACAGG No data
938263185_938263199 18 Left 938263185 2:129909590-129909612 CCATGAGGGTCCTCCCAAAGCCC No data
Right 938263199 2:129909631-129909653 AGGACAGGAAGGGTGAGAGATGG No data
938263185_938263202 30 Left 938263185 2:129909590-129909612 CCATGAGGGTCCTCCCAAAGCCC No data
Right 938263202 2:129909643-129909665 GTGAGAGATGGCGGAGAAGCGGG No data
938263185_938263201 29 Left 938263185 2:129909590-129909612 CCATGAGGGTCCTCCCAAAGCCC No data
Right 938263201 2:129909642-129909664 GGTGAGAGATGGCGGAGAAGCGG No data
938263185_938263189 -10 Left 938263185 2:129909590-129909612 CCATGAGGGTCCTCCCAAAGCCC No data
Right 938263189 2:129909603-129909625 CCCAAAGCCCACTCCACTGTGGG No data
938263185_938263198 8 Left 938263185 2:129909590-129909612 CCATGAGGGTCCTCCCAAAGCCC No data
Right 938263198 2:129909621-129909643 GTGGGGTTGCAGGACAGGAAGGG No data
938263185_938263197 7 Left 938263185 2:129909590-129909612 CCATGAGGGTCCTCCCAAAGCCC No data
Right 938263197 2:129909620-129909642 TGTGGGGTTGCAGGACAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938263185 Original CRISPR GGGCTTTGGGAGGACCCTCA TGG (reversed) Intergenic
No off target data available for this crispr