ID: 938263186

View in Genome Browser
Species Human (GRCh38)
Location 2:129909600-129909622
Sequence ACAGTGGAGTGGGCTTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938263186_938263202 20 Left 938263186 2:129909600-129909622 CCTCCCAAAGCCCACTCCACTGT No data
Right 938263202 2:129909643-129909665 GTGAGAGATGGCGGAGAAGCGGG No data
938263186_938263197 -3 Left 938263186 2:129909600-129909622 CCTCCCAAAGCCCACTCCACTGT No data
Right 938263197 2:129909620-129909642 TGTGGGGTTGCAGGACAGGAAGG No data
938263186_938263201 19 Left 938263186 2:129909600-129909622 CCTCCCAAAGCCCACTCCACTGT No data
Right 938263201 2:129909642-129909664 GGTGAGAGATGGCGGAGAAGCGG No data
938263186_938263198 -2 Left 938263186 2:129909600-129909622 CCTCCCAAAGCCCACTCCACTGT No data
Right 938263198 2:129909621-129909643 GTGGGGTTGCAGGACAGGAAGGG No data
938263186_938263200 11 Left 938263186 2:129909600-129909622 CCTCCCAAAGCCCACTCCACTGT No data
Right 938263200 2:129909634-129909656 ACAGGAAGGGTGAGAGATGGCGG No data
938263186_938263199 8 Left 938263186 2:129909600-129909622 CCTCCCAAAGCCCACTCCACTGT No data
Right 938263199 2:129909631-129909653 AGGACAGGAAGGGTGAGAGATGG No data
938263186_938263196 -7 Left 938263186 2:129909600-129909622 CCTCCCAAAGCCCACTCCACTGT No data
Right 938263196 2:129909616-129909638 CCACTGTGGGGTTGCAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938263186 Original CRISPR ACAGTGGAGTGGGCTTTGGG AGG (reversed) Intergenic
No off target data available for this crispr