ID: 938263187

View in Genome Browser
Species Human (GRCh38)
Location 2:129909602-129909624
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938263172_938263187 12 Left 938263172 2:129909567-129909589 CCTCCCCACTGTCCACCCCCACC No data
Right 938263187 2:129909602-129909624 TCCCAAAGCCCACTCCACTGTGG No data
938263184_938263187 -10 Left 938263184 2:129909589-129909611 CCCATGAGGGTCCTCCCAAAGCC No data
Right 938263187 2:129909602-129909624 TCCCAAAGCCCACTCCACTGTGG No data
938263175_938263187 7 Left 938263175 2:129909572-129909594 CCACTGTCCACCCCCACCCCATG No data
Right 938263187 2:129909602-129909624 TCCCAAAGCCCACTCCACTGTGG No data
938263181_938263187 -5 Left 938263181 2:129909584-129909606 CCCACCCCATGAGGGTCCTCCCA No data
Right 938263187 2:129909602-129909624 TCCCAAAGCCCACTCCACTGTGG No data
938263170_938263187 14 Left 938263170 2:129909565-129909587 CCCCTCCCCACTGTCCACCCCCA No data
Right 938263187 2:129909602-129909624 TCCCAAAGCCCACTCCACTGTGG No data
938263182_938263187 -6 Left 938263182 2:129909585-129909607 CCACCCCATGAGGGTCCTCCCAA No data
Right 938263187 2:129909602-129909624 TCCCAAAGCCCACTCCACTGTGG No data
938263183_938263187 -9 Left 938263183 2:129909588-129909610 CCCCATGAGGGTCCTCCCAAAGC No data
Right 938263187 2:129909602-129909624 TCCCAAAGCCCACTCCACTGTGG No data
938263171_938263187 13 Left 938263171 2:129909566-129909588 CCCTCCCCACTGTCCACCCCCAC No data
Right 938263187 2:129909602-129909624 TCCCAAAGCCCACTCCACTGTGG No data
938263180_938263187 -4 Left 938263180 2:129909583-129909605 CCCCACCCCATGAGGGTCCTCCC No data
Right 938263187 2:129909602-129909624 TCCCAAAGCCCACTCCACTGTGG No data
938263174_938263187 8 Left 938263174 2:129909571-129909593 CCCACTGTCCACCCCCACCCCAT No data
Right 938263187 2:129909602-129909624 TCCCAAAGCCCACTCCACTGTGG No data
938263178_938263187 0 Left 938263178 2:129909579-129909601 CCACCCCCACCCCATGAGGGTCC No data
Right 938263187 2:129909602-129909624 TCCCAAAGCCCACTCCACTGTGG No data
938263173_938263187 9 Left 938263173 2:129909570-129909592 CCCCACTGTCCACCCCCACCCCA No data
Right 938263187 2:129909602-129909624 TCCCAAAGCCCACTCCACTGTGG No data
938263179_938263187 -3 Left 938263179 2:129909582-129909604 CCCCCACCCCATGAGGGTCCTCC No data
Right 938263187 2:129909602-129909624 TCCCAAAGCCCACTCCACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr