ID: 938263190

View in Genome Browser
Species Human (GRCh38)
Location 2:129909604-129909626
Sequence CCCCACAGTGGAGTGGGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938263190_938263204 30 Left 938263190 2:129909604-129909626 CCAAAGCCCACTCCACTGTGGGG No data
Right 938263204 2:129909657-129909679 AGAAGCGGGAACTCCAGCCTGGG No data
938263190_938263200 7 Left 938263190 2:129909604-129909626 CCAAAGCCCACTCCACTGTGGGG No data
Right 938263200 2:129909634-129909656 ACAGGAAGGGTGAGAGATGGCGG No data
938263190_938263203 29 Left 938263190 2:129909604-129909626 CCAAAGCCCACTCCACTGTGGGG No data
Right 938263203 2:129909656-129909678 GAGAAGCGGGAACTCCAGCCTGG No data
938263190_938263201 15 Left 938263190 2:129909604-129909626 CCAAAGCCCACTCCACTGTGGGG No data
Right 938263201 2:129909642-129909664 GGTGAGAGATGGCGGAGAAGCGG No data
938263190_938263197 -7 Left 938263190 2:129909604-129909626 CCAAAGCCCACTCCACTGTGGGG No data
Right 938263197 2:129909620-129909642 TGTGGGGTTGCAGGACAGGAAGG No data
938263190_938263202 16 Left 938263190 2:129909604-129909626 CCAAAGCCCACTCCACTGTGGGG No data
Right 938263202 2:129909643-129909665 GTGAGAGATGGCGGAGAAGCGGG No data
938263190_938263198 -6 Left 938263190 2:129909604-129909626 CCAAAGCCCACTCCACTGTGGGG No data
Right 938263198 2:129909621-129909643 GTGGGGTTGCAGGACAGGAAGGG No data
938263190_938263199 4 Left 938263190 2:129909604-129909626 CCAAAGCCCACTCCACTGTGGGG No data
Right 938263199 2:129909631-129909653 AGGACAGGAAGGGTGAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938263190 Original CRISPR CCCCACAGTGGAGTGGGCTT TGG (reversed) Intergenic
No off target data available for this crispr