ID: 938263192

View in Genome Browser
Species Human (GRCh38)
Location 2:129909610-129909632
Sequence CTGCAACCCCACAGTGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938263192_938263200 1 Left 938263192 2:129909610-129909632 CCCACTCCACTGTGGGGTTGCAG No data
Right 938263200 2:129909634-129909656 ACAGGAAGGGTGAGAGATGGCGG No data
938263192_938263204 24 Left 938263192 2:129909610-129909632 CCCACTCCACTGTGGGGTTGCAG No data
Right 938263204 2:129909657-129909679 AGAAGCGGGAACTCCAGCCTGGG No data
938263192_938263202 10 Left 938263192 2:129909610-129909632 CCCACTCCACTGTGGGGTTGCAG No data
Right 938263202 2:129909643-129909665 GTGAGAGATGGCGGAGAAGCGGG No data
938263192_938263199 -2 Left 938263192 2:129909610-129909632 CCCACTCCACTGTGGGGTTGCAG No data
Right 938263199 2:129909631-129909653 AGGACAGGAAGGGTGAGAGATGG No data
938263192_938263203 23 Left 938263192 2:129909610-129909632 CCCACTCCACTGTGGGGTTGCAG No data
Right 938263203 2:129909656-129909678 GAGAAGCGGGAACTCCAGCCTGG No data
938263192_938263201 9 Left 938263192 2:129909610-129909632 CCCACTCCACTGTGGGGTTGCAG No data
Right 938263201 2:129909642-129909664 GGTGAGAGATGGCGGAGAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938263192 Original CRISPR CTGCAACCCCACAGTGGAGT GGG (reversed) Intergenic
No off target data available for this crispr