ID: 938263198

View in Genome Browser
Species Human (GRCh38)
Location 2:129909621-129909643
Sequence GTGGGGTTGCAGGACAGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938263184_938263198 9 Left 938263184 2:129909589-129909611 CCCATGAGGGTCCTCCCAAAGCC No data
Right 938263198 2:129909621-129909643 GTGGGGTTGCAGGACAGGAAGGG No data
938263178_938263198 19 Left 938263178 2:129909579-129909601 CCACCCCCACCCCATGAGGGTCC No data
Right 938263198 2:129909621-129909643 GTGGGGTTGCAGGACAGGAAGGG No data
938263183_938263198 10 Left 938263183 2:129909588-129909610 CCCCATGAGGGTCCTCCCAAAGC No data
Right 938263198 2:129909621-129909643 GTGGGGTTGCAGGACAGGAAGGG No data
938263179_938263198 16 Left 938263179 2:129909582-129909604 CCCCCACCCCATGAGGGTCCTCC No data
Right 938263198 2:129909621-129909643 GTGGGGTTGCAGGACAGGAAGGG No data
938263175_938263198 26 Left 938263175 2:129909572-129909594 CCACTGTCCACCCCCACCCCATG No data
Right 938263198 2:129909621-129909643 GTGGGGTTGCAGGACAGGAAGGG No data
938263182_938263198 13 Left 938263182 2:129909585-129909607 CCACCCCATGAGGGTCCTCCCAA No data
Right 938263198 2:129909621-129909643 GTGGGGTTGCAGGACAGGAAGGG No data
938263188_938263198 -5 Left 938263188 2:129909603-129909625 CCCAAAGCCCACTCCACTGTGGG No data
Right 938263198 2:129909621-129909643 GTGGGGTTGCAGGACAGGAAGGG No data
938263181_938263198 14 Left 938263181 2:129909584-129909606 CCCACCCCATGAGGGTCCTCCCA No data
Right 938263198 2:129909621-129909643 GTGGGGTTGCAGGACAGGAAGGG No data
938263186_938263198 -2 Left 938263186 2:129909600-129909622 CCTCCCAAAGCCCACTCCACTGT No data
Right 938263198 2:129909621-129909643 GTGGGGTTGCAGGACAGGAAGGG No data
938263173_938263198 28 Left 938263173 2:129909570-129909592 CCCCACTGTCCACCCCCACCCCA No data
Right 938263198 2:129909621-129909643 GTGGGGTTGCAGGACAGGAAGGG No data
938263190_938263198 -6 Left 938263190 2:129909604-129909626 CCAAAGCCCACTCCACTGTGGGG No data
Right 938263198 2:129909621-129909643 GTGGGGTTGCAGGACAGGAAGGG No data
938263185_938263198 8 Left 938263185 2:129909590-129909612 CCATGAGGGTCCTCCCAAAGCCC No data
Right 938263198 2:129909621-129909643 GTGGGGTTGCAGGACAGGAAGGG No data
938263174_938263198 27 Left 938263174 2:129909571-129909593 CCCACTGTCCACCCCCACCCCAT No data
Right 938263198 2:129909621-129909643 GTGGGGTTGCAGGACAGGAAGGG No data
938263180_938263198 15 Left 938263180 2:129909583-129909605 CCCCACCCCATGAGGGTCCTCCC No data
Right 938263198 2:129909621-129909643 GTGGGGTTGCAGGACAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938263198 Original CRISPR GTGGGGTTGCAGGACAGGAA GGG Intergenic
No off target data available for this crispr