ID: 938263199

View in Genome Browser
Species Human (GRCh38)
Location 2:129909631-129909653
Sequence AGGACAGGAAGGGTGAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938263188_938263199 5 Left 938263188 2:129909603-129909625 CCCAAAGCCCACTCCACTGTGGG No data
Right 938263199 2:129909631-129909653 AGGACAGGAAGGGTGAGAGATGG No data
938263186_938263199 8 Left 938263186 2:129909600-129909622 CCTCCCAAAGCCCACTCCACTGT No data
Right 938263199 2:129909631-129909653 AGGACAGGAAGGGTGAGAGATGG No data
938263182_938263199 23 Left 938263182 2:129909585-129909607 CCACCCCATGAGGGTCCTCCCAA No data
Right 938263199 2:129909631-129909653 AGGACAGGAAGGGTGAGAGATGG No data
938263195_938263199 -8 Left 938263195 2:129909616-129909638 CCACTGTGGGGTTGCAGGACAGG No data
Right 938263199 2:129909631-129909653 AGGACAGGAAGGGTGAGAGATGG No data
938263180_938263199 25 Left 938263180 2:129909583-129909605 CCCCACCCCATGAGGGTCCTCCC No data
Right 938263199 2:129909631-129909653 AGGACAGGAAGGGTGAGAGATGG No data
938263179_938263199 26 Left 938263179 2:129909582-129909604 CCCCCACCCCATGAGGGTCCTCC No data
Right 938263199 2:129909631-129909653 AGGACAGGAAGGGTGAGAGATGG No data
938263192_938263199 -2 Left 938263192 2:129909610-129909632 CCCACTCCACTGTGGGGTTGCAG No data
Right 938263199 2:129909631-129909653 AGGACAGGAAGGGTGAGAGATGG No data
938263178_938263199 29 Left 938263178 2:129909579-129909601 CCACCCCCACCCCATGAGGGTCC No data
Right 938263199 2:129909631-129909653 AGGACAGGAAGGGTGAGAGATGG No data
938263193_938263199 -3 Left 938263193 2:129909611-129909633 CCACTCCACTGTGGGGTTGCAGG No data
Right 938263199 2:129909631-129909653 AGGACAGGAAGGGTGAGAGATGG No data
938263185_938263199 18 Left 938263185 2:129909590-129909612 CCATGAGGGTCCTCCCAAAGCCC No data
Right 938263199 2:129909631-129909653 AGGACAGGAAGGGTGAGAGATGG No data
938263184_938263199 19 Left 938263184 2:129909589-129909611 CCCATGAGGGTCCTCCCAAAGCC No data
Right 938263199 2:129909631-129909653 AGGACAGGAAGGGTGAGAGATGG No data
938263181_938263199 24 Left 938263181 2:129909584-129909606 CCCACCCCATGAGGGTCCTCCCA No data
Right 938263199 2:129909631-129909653 AGGACAGGAAGGGTGAGAGATGG No data
938263190_938263199 4 Left 938263190 2:129909604-129909626 CCAAAGCCCACTCCACTGTGGGG No data
Right 938263199 2:129909631-129909653 AGGACAGGAAGGGTGAGAGATGG No data
938263183_938263199 20 Left 938263183 2:129909588-129909610 CCCCATGAGGGTCCTCCCAAAGC No data
Right 938263199 2:129909631-129909653 AGGACAGGAAGGGTGAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938263199 Original CRISPR AGGACAGGAAGGGTGAGAGA TGG Intergenic
No off target data available for this crispr