ID: 938263200

View in Genome Browser
Species Human (GRCh38)
Location 2:129909634-129909656
Sequence ACAGGAAGGGTGAGAGATGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938263192_938263200 1 Left 938263192 2:129909610-129909632 CCCACTCCACTGTGGGGTTGCAG No data
Right 938263200 2:129909634-129909656 ACAGGAAGGGTGAGAGATGGCGG No data
938263195_938263200 -5 Left 938263195 2:129909616-129909638 CCACTGTGGGGTTGCAGGACAGG No data
Right 938263200 2:129909634-129909656 ACAGGAAGGGTGAGAGATGGCGG No data
938263186_938263200 11 Left 938263186 2:129909600-129909622 CCTCCCAAAGCCCACTCCACTGT No data
Right 938263200 2:129909634-129909656 ACAGGAAGGGTGAGAGATGGCGG No data
938263182_938263200 26 Left 938263182 2:129909585-129909607 CCACCCCATGAGGGTCCTCCCAA No data
Right 938263200 2:129909634-129909656 ACAGGAAGGGTGAGAGATGGCGG No data
938263185_938263200 21 Left 938263185 2:129909590-129909612 CCATGAGGGTCCTCCCAAAGCCC No data
Right 938263200 2:129909634-129909656 ACAGGAAGGGTGAGAGATGGCGG No data
938263184_938263200 22 Left 938263184 2:129909589-129909611 CCCATGAGGGTCCTCCCAAAGCC No data
Right 938263200 2:129909634-129909656 ACAGGAAGGGTGAGAGATGGCGG No data
938263183_938263200 23 Left 938263183 2:129909588-129909610 CCCCATGAGGGTCCTCCCAAAGC No data
Right 938263200 2:129909634-129909656 ACAGGAAGGGTGAGAGATGGCGG No data
938263181_938263200 27 Left 938263181 2:129909584-129909606 CCCACCCCATGAGGGTCCTCCCA No data
Right 938263200 2:129909634-129909656 ACAGGAAGGGTGAGAGATGGCGG No data
938263188_938263200 8 Left 938263188 2:129909603-129909625 CCCAAAGCCCACTCCACTGTGGG No data
Right 938263200 2:129909634-129909656 ACAGGAAGGGTGAGAGATGGCGG No data
938263190_938263200 7 Left 938263190 2:129909604-129909626 CCAAAGCCCACTCCACTGTGGGG No data
Right 938263200 2:129909634-129909656 ACAGGAAGGGTGAGAGATGGCGG No data
938263180_938263200 28 Left 938263180 2:129909583-129909605 CCCCACCCCATGAGGGTCCTCCC No data
Right 938263200 2:129909634-129909656 ACAGGAAGGGTGAGAGATGGCGG No data
938263193_938263200 0 Left 938263193 2:129909611-129909633 CCACTCCACTGTGGGGTTGCAGG No data
Right 938263200 2:129909634-129909656 ACAGGAAGGGTGAGAGATGGCGG No data
938263179_938263200 29 Left 938263179 2:129909582-129909604 CCCCCACCCCATGAGGGTCCTCC No data
Right 938263200 2:129909634-129909656 ACAGGAAGGGTGAGAGATGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938263200 Original CRISPR ACAGGAAGGGTGAGAGATGG CGG Intergenic
No off target data available for this crispr