ID: 938263201

View in Genome Browser
Species Human (GRCh38)
Location 2:129909642-129909664
Sequence GGTGAGAGATGGCGGAGAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938263195_938263201 3 Left 938263195 2:129909616-129909638 CCACTGTGGGGTTGCAGGACAGG No data
Right 938263201 2:129909642-129909664 GGTGAGAGATGGCGGAGAAGCGG No data
938263190_938263201 15 Left 938263190 2:129909604-129909626 CCAAAGCCCACTCCACTGTGGGG No data
Right 938263201 2:129909642-129909664 GGTGAGAGATGGCGGAGAAGCGG No data
938263192_938263201 9 Left 938263192 2:129909610-129909632 CCCACTCCACTGTGGGGTTGCAG No data
Right 938263201 2:129909642-129909664 GGTGAGAGATGGCGGAGAAGCGG No data
938263188_938263201 16 Left 938263188 2:129909603-129909625 CCCAAAGCCCACTCCACTGTGGG No data
Right 938263201 2:129909642-129909664 GGTGAGAGATGGCGGAGAAGCGG No data
938263193_938263201 8 Left 938263193 2:129909611-129909633 CCACTCCACTGTGGGGTTGCAGG No data
Right 938263201 2:129909642-129909664 GGTGAGAGATGGCGGAGAAGCGG No data
938263185_938263201 29 Left 938263185 2:129909590-129909612 CCATGAGGGTCCTCCCAAAGCCC No data
Right 938263201 2:129909642-129909664 GGTGAGAGATGGCGGAGAAGCGG No data
938263186_938263201 19 Left 938263186 2:129909600-129909622 CCTCCCAAAGCCCACTCCACTGT No data
Right 938263201 2:129909642-129909664 GGTGAGAGATGGCGGAGAAGCGG No data
938263184_938263201 30 Left 938263184 2:129909589-129909611 CCCATGAGGGTCCTCCCAAAGCC No data
Right 938263201 2:129909642-129909664 GGTGAGAGATGGCGGAGAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938263201 Original CRISPR GGTGAGAGATGGCGGAGAAG CGG Intergenic
No off target data available for this crispr