ID: 938263202

View in Genome Browser
Species Human (GRCh38)
Location 2:129909643-129909665
Sequence GTGAGAGATGGCGGAGAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938263193_938263202 9 Left 938263193 2:129909611-129909633 CCACTCCACTGTGGGGTTGCAGG No data
Right 938263202 2:129909643-129909665 GTGAGAGATGGCGGAGAAGCGGG No data
938263195_938263202 4 Left 938263195 2:129909616-129909638 CCACTGTGGGGTTGCAGGACAGG No data
Right 938263202 2:129909643-129909665 GTGAGAGATGGCGGAGAAGCGGG No data
938263192_938263202 10 Left 938263192 2:129909610-129909632 CCCACTCCACTGTGGGGTTGCAG No data
Right 938263202 2:129909643-129909665 GTGAGAGATGGCGGAGAAGCGGG No data
938263185_938263202 30 Left 938263185 2:129909590-129909612 CCATGAGGGTCCTCCCAAAGCCC No data
Right 938263202 2:129909643-129909665 GTGAGAGATGGCGGAGAAGCGGG No data
938263188_938263202 17 Left 938263188 2:129909603-129909625 CCCAAAGCCCACTCCACTGTGGG No data
Right 938263202 2:129909643-129909665 GTGAGAGATGGCGGAGAAGCGGG No data
938263186_938263202 20 Left 938263186 2:129909600-129909622 CCTCCCAAAGCCCACTCCACTGT No data
Right 938263202 2:129909643-129909665 GTGAGAGATGGCGGAGAAGCGGG No data
938263190_938263202 16 Left 938263190 2:129909604-129909626 CCAAAGCCCACTCCACTGTGGGG No data
Right 938263202 2:129909643-129909665 GTGAGAGATGGCGGAGAAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938263202 Original CRISPR GTGAGAGATGGCGGAGAAGC GGG Intergenic
No off target data available for this crispr