ID: 938265225

View in Genome Browser
Species Human (GRCh38)
Location 2:129923426-129923448
Sequence GAGGGTCCCAGCGCCCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938265225_938265233 4 Left 938265225 2:129923426-129923448 CCCCAGGGGGCGCTGGGACCCTC No data
Right 938265233 2:129923453-129923475 CTATCCAGGCTACACCTGTGCGG No data
938265225_938265228 -10 Left 938265225 2:129923426-129923448 CCCCAGGGGGCGCTGGGACCCTC No data
Right 938265228 2:129923439-129923461 TGGGACCCTCCCTGCTATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938265225 Original CRISPR GAGGGTCCCAGCGCCCCCTG GGG (reversed) Intergenic
No off target data available for this crispr