ID: 938265953

View in Genome Browser
Species Human (GRCh38)
Location 2:129928388-129928410
Sequence GAGTTCCAGGCATTTGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938265953_938265961 15 Left 938265953 2:129928388-129928410 CCATCTGCAAATGCCTGGAACTC No data
Right 938265961 2:129928426-129928448 CAGGCCTCATCTCAGCAAGATGG No data
938265953_938265962 16 Left 938265953 2:129928388-129928410 CCATCTGCAAATGCCTGGAACTC No data
Right 938265962 2:129928427-129928449 AGGCCTCATCTCAGCAAGATGGG No data
938265953_938265956 -4 Left 938265953 2:129928388-129928410 CCATCTGCAAATGCCTGGAACTC No data
Right 938265956 2:129928407-129928429 ACTCAGGCACCCTCACCTCCAGG No data
938265953_938265963 17 Left 938265953 2:129928388-129928410 CCATCTGCAAATGCCTGGAACTC No data
Right 938265963 2:129928428-129928450 GGCCTCATCTCAGCAAGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938265953 Original CRISPR GAGTTCCAGGCATTTGCAGA TGG (reversed) Intergenic