ID: 938265955

View in Genome Browser
Species Human (GRCh38)
Location 2:129928401-129928423
Sequence GGTGAGGGTGCCTGAGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938265955_938265963 4 Left 938265955 2:129928401-129928423 CCTGGAACTCAGGCACCCTCACC No data
Right 938265963 2:129928428-129928450 GGCCTCATCTCAGCAAGATGGGG No data
938265955_938265962 3 Left 938265955 2:129928401-129928423 CCTGGAACTCAGGCACCCTCACC No data
Right 938265962 2:129928427-129928449 AGGCCTCATCTCAGCAAGATGGG No data
938265955_938265961 2 Left 938265955 2:129928401-129928423 CCTGGAACTCAGGCACCCTCACC No data
Right 938265961 2:129928426-129928448 CAGGCCTCATCTCAGCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938265955 Original CRISPR GGTGAGGGTGCCTGAGTTCC AGG (reversed) Intergenic
No off target data available for this crispr