ID: 938265963

View in Genome Browser
Species Human (GRCh38)
Location 2:129928428-129928450
Sequence GGCCTCATCTCAGCAAGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938265953_938265963 17 Left 938265953 2:129928388-129928410 CCATCTGCAAATGCCTGGAACTC No data
Right 938265963 2:129928428-129928450 GGCCTCATCTCAGCAAGATGGGG No data
938265955_938265963 4 Left 938265955 2:129928401-129928423 CCTGGAACTCAGGCACCCTCACC No data
Right 938265963 2:129928428-129928450 GGCCTCATCTCAGCAAGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938265963 Original CRISPR GGCCTCATCTCAGCAAGATG GGG Intergenic