ID: 938270126

View in Genome Browser
Species Human (GRCh38)
Location 2:129962612-129962634
Sequence GGCCGCAGGAACCTCTGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3256
Summary {0: 5, 1: 406, 2: 1694, 3: 781, 4: 370}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938270126_938270132 15 Left 938270126 2:129962612-129962634 CCTAGGCAGAGGTTCCTGCGGCC 0: 5
1: 406
2: 1694
3: 781
4: 370
Right 938270132 2:129962650-129962672 GTCCCTGGGTACTTGAGATTAGG 0: 2037
1: 514
2: 379
3: 36
4: 110
938270126_938270136 21 Left 938270126 2:129962612-129962634 CCTAGGCAGAGGTTCCTGCGGCC 0: 5
1: 406
2: 1694
3: 781
4: 370
Right 938270136 2:129962656-129962678 GGGTACTTGAGATTAGGGAGTGG 0: 2088
1: 498
2: 162
3: 314
4: 1246
938270126_938270129 0 Left 938270126 2:129962612-129962634 CCTAGGCAGAGGTTCCTGCGGCC 0: 5
1: 406
2: 1694
3: 781
4: 370
Right 938270129 2:129962635-129962657 TTCCGCAGTTTCTGTGTCCCTGG No data
938270126_938270130 1 Left 938270126 2:129962612-129962634 CCTAGGCAGAGGTTCCTGCGGCC 0: 5
1: 406
2: 1694
3: 781
4: 370
Right 938270130 2:129962636-129962658 TCCGCAGTTTCTGTGTCCCTGGG No data
938270126_938270133 16 Left 938270126 2:129962612-129962634 CCTAGGCAGAGGTTCCTGCGGCC 0: 5
1: 406
2: 1694
3: 781
4: 370
Right 938270133 2:129962651-129962673 TCCCTGGGTACTTGAGATTAGGG 0: 2042
1: 517
2: 380
3: 30
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938270126 Original CRISPR GGCCGCAGGAACCTCTGCCT AGG (reversed) Intergenic
Too many off-targets to display for this crispr