ID: 938279066

View in Genome Browser
Species Human (GRCh38)
Location 2:130051870-130051892
Sequence GAGAATGGGGAGCACAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938279055_938279066 11 Left 938279055 2:130051836-130051858 CCCTGCTGGCTGACACTGGAAAA No data
Right 938279066 2:130051870-130051892 GAGAATGGGGAGCACAAGGCTGG No data
938279056_938279066 10 Left 938279056 2:130051837-130051859 CCTGCTGGCTGACACTGGAAAAG No data
Right 938279066 2:130051870-130051892 GAGAATGGGGAGCACAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938279066 Original CRISPR GAGAATGGGGAGCACAAGGC TGG Intergenic
No off target data available for this crispr