ID: 938286242

View in Genome Browser
Species Human (GRCh38)
Location 2:130120167-130120189
Sequence CAGGGGGAGCAGCAAGAGCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 808
Summary {0: 1, 1: 2, 2: 8, 3: 94, 4: 703}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938286242_938286249 -5 Left 938286242 2:130120167-130120189 CCTTGCTCTTGCTGCTCCCCCTG 0: 1
1: 2
2: 8
3: 94
4: 703
Right 938286249 2:130120185-130120207 CCCTGCAGCAGGGGAAGCAGTGG 0: 18
1: 14
2: 6
3: 84
4: 835

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938286242 Original CRISPR CAGGGGGAGCAGCAAGAGCA AGG (reversed) Exonic
900018678 1:171833-171855 GAGGGGGAACAGCATGAGCCAGG + Intergenic
900048936 1:530428-530450 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
900071167 1:772252-772274 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
900131655 1:1089774-1089796 CAGTGGGAGCAGCCAGGGGAGGG - Intronic
900151475 1:1180960-1180982 CAGGGGCAGGGGCAAGGGCAGGG - Intronic
900151499 1:1181018-1181040 CAGGGGCAGGGGCAAGGGCAGGG - Intronic
900204500 1:1426285-1426307 CAGGAGGTGCAGCAGGAGCCCGG - Exonic
900311189 1:2033946-2033968 CAGAGGCAGGAGCTAGAGCAGGG + Intergenic
900317784 1:2068100-2068122 TTGGGGCAGCAGCGAGAGCAAGG + Intronic
900392276 1:2438857-2438879 CAGGGGGCGCAGCGTGTGCAGGG + Intronic
900929322 1:5726358-5726380 CAGAGGCAGCTGCAGGAGCAAGG + Intergenic
900929435 1:5726926-5726948 CAGAGGCAGCTGCAGGAGCAAGG - Intergenic
900951483 1:5860431-5860453 GACGGGGAACAGCAGGAGCAGGG + Intergenic
901195715 1:7438757-7438779 CTGGTGGAGCAGAAAGAGCATGG + Intronic
902408462 1:16199299-16199321 CAGGGGGAGGAGCATGGGTAGGG + Intronic
902456422 1:16536681-16536703 CAGTGGGACCAGCAGGAGCCTGG - Intergenic
902495741 1:16871230-16871252 CAGTGGGACCAGCAGGAGCCTGG + Intronic
902623213 1:17662461-17662483 CAAGGGAAGCAGGCAGAGCAGGG - Intronic
902826662 1:18979243-18979265 CAGAGGGAACAGCAAGACCATGG + Intergenic
903007694 1:20309471-20309493 CAGGCAGAGCAGCAAGCACAGGG + Intronic
903009913 1:20322407-20322429 GAGGGGGAGAAGCAAGGGGAAGG + Intronic
903061536 1:20672077-20672099 CAGGAGCTGCTGCAAGAGCATGG + Exonic
903219529 1:21861328-21861350 CAGAGGGAACAGCATAAGCAAGG + Intronic
903276599 1:22225960-22225982 CCGGGGCAGCAGCGAGGGCAGGG + Intergenic
903352445 1:22725871-22725893 CAGGGGGAGATGCAACAGCAGGG + Intronic
903403246 1:23073655-23073677 CAGGGCCAGGAGCCAGAGCATGG - Intronic
903438900 1:23372288-23372310 CAGGGGGAGGAAGCAGAGCACGG + Intergenic
903461946 1:23526427-23526449 CAGCAGGAGCACCAAGGGCAGGG + Intronic
903674327 1:25054750-25054772 CATGGGGAGCAGGGGGAGCAGGG + Intergenic
903739086 1:25547870-25547892 TAGAGGGAACAGCAAGTGCAGGG + Intronic
903849263 1:26296482-26296504 CAGAGGGAACAGCAACAGCACGG + Intronic
903883042 1:26525078-26525100 AACTGGGAGCAGCAAGAGCTGGG + Intergenic
903885299 1:26537486-26537508 CAGGGGAAGCAGAGATAGCAGGG - Intronic
904008705 1:27377831-27377853 CTGGGGGAGAAACAAGGGCAGGG + Intergenic
904241445 1:29148841-29148863 CAGGAGCCGCAGCAAGAGCAAGG - Exonic
904321239 1:29698896-29698918 CAGGGGCAGGGGCAGGAGCAGGG - Intergenic
904598569 1:31661677-31661699 CAGGGGGGCCAGCAGGACCAGGG + Exonic
904766479 1:32852651-32852673 CAGGGGGAGTAACTATAGCAGGG - Intronic
904801501 1:33096258-33096280 GAGGAGGAGCAGGAAGAGGAGGG + Intronic
904810617 1:33161292-33161314 CAGAGGGAGCCGCATGAGGAAGG + Intronic
904921573 1:34012223-34012245 CAGCGGGAAGAGCAAGGGCAAGG - Intronic
904936139 1:34131064-34131086 GAGGTGGAGAAACAAGAGCAGGG - Intronic
905295691 1:36953176-36953198 CAGGGGGAGGGGCAAGGACAGGG - Intronic
905322952 1:37130676-37130698 CAGTGGGAGCAAGAAGGGCATGG + Intergenic
905415974 1:37804450-37804472 AAGAGGGAGAAGGAAGAGCATGG + Intronic
905695793 1:39972706-39972728 CAGCAGGAGCTGCAAGACCAGGG - Intergenic
906034085 1:42740159-42740181 CAGGGGGAGCAGCGAGAAGGAGG + Exonic
906541811 1:46592627-46592649 CAGGGAGAGCAGGGAGAGCAAGG + Intronic
907309124 1:53529349-53529371 CGGAGGGGGCAGGAAGAGCAGGG + Intronic
907606431 1:55822360-55822382 CAGGGGGAGATGCATGAACAGGG + Intergenic
908267543 1:62394145-62394167 CCTGGGAAGCAGCAAGAGGAGGG - Intergenic
908463657 1:64370282-64370304 CAGAGGGAACAGCTAGTGCATGG + Intergenic
909498312 1:76304516-76304538 CAGGAGGAGCAGCATGAACAAGG + Intronic
910034882 1:82777722-82777744 AAGGGTGAGCAGCAACAGCACGG + Intergenic
911024942 1:93426607-93426629 CAGAGTGAGCACCAATAGCAGGG - Intergenic
911143833 1:94533696-94533718 GAGGAGGAGGAGGAAGAGCAGGG - Intronic
911740426 1:101381030-101381052 CAGCCAGAGCAGCAAGAACAGGG - Intergenic
912285589 1:108365157-108365179 GAGTGGGAGCAGAAAGAGGAAGG - Intergenic
913968834 1:143398533-143398555 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
914063213 1:144224132-144224154 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
914115937 1:144742222-144742244 AAGAGGAAGCAGCAAGTGCAAGG + Intergenic
914244619 1:145876442-145876464 CAGGAGGAGAAGGAAGAGAAGGG + Intronic
915191869 1:154157601-154157623 CAGAGGGAGGAGCAGCAGCAGGG + Intronic
915268410 1:154734688-154734710 GTCAGGGAGCAGCAAGAGCATGG + Intronic
915320869 1:155055867-155055889 CAGGGGGAGGAGGATGTGCAGGG - Intronic
915622789 1:157096142-157096164 CAGAGGGAGTAGGGAGAGCATGG - Intronic
916606021 1:166343156-166343178 CAGGGGGAGCAGGGGGAGCAGGG + Intergenic
917173738 1:172207561-172207583 CAGGGAGAGCAACAGGAGAAAGG + Intronic
917494020 1:175523958-175523980 TAGGAGGAGCAGCATGGGCAAGG - Intronic
918499331 1:185176426-185176448 CAGAGGGAGCTACATGAGCAGGG + Intronic
918651093 1:186964505-186964527 GAGAGGGAGGAGCTAGAGCAAGG - Intronic
919566421 1:199194605-199194627 CAGTGGCAGCACCAAGAGTATGG - Intergenic
919796671 1:201325220-201325242 TAGGGGAAGCACCAAGGGCAGGG + Intronic
919802008 1:201359764-201359786 CAGGAGGAGAAGGAGGAGCATGG + Intronic
919879945 1:201894817-201894839 CAGGGGAAGGAGCTAGGGCAGGG + Intergenic
920398827 1:205664588-205664610 CAGGTTGACCAGCAAGAGCTGGG + Exonic
920857597 1:209675627-209675649 CAGGAGGAGCAGCAGGAGAGGGG - Intronic
922106528 1:222517701-222517723 GAGGGGGGGCAGCATGAGCCAGG + Intergenic
922229270 1:223671639-223671661 CAAGGGGAACAGCAAGAAAATGG + Intergenic
922574886 1:226654937-226654959 GAGGGGGAGGAGGAAGAGGAGGG + Intronic
922762959 1:228143734-228143756 CTGGGTGAGCAGCAGGAGCCAGG + Intronic
923000397 1:230002283-230002305 CAGGTGCAGCAGGAGGAGCAAGG + Intergenic
923322426 1:232847875-232847897 CTGGGGAAGGAGCAAGAGCATGG + Intergenic
923507948 1:234622697-234622719 GAGGAGGAGGAGGAAGAGCAGGG - Intergenic
924258561 1:242206744-242206766 CAGGAGGAGGAGGAAGAGGATGG + Intronic
924348712 1:243095267-243095289 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
924949012 1:248865762-248865784 CATGGGGCTCAGCTAGAGCAAGG + Intergenic
1062975027 10:1676834-1676856 CAGGGGAAGCATGAAGAGGATGG + Intronic
1063266939 10:4462608-4462630 CAGGGGGAGCACCGATTGCAAGG + Intergenic
1064283287 10:13970309-13970331 CAGGTGAAGAAGCAGGAGCAGGG + Intronic
1064577613 10:16762010-16762032 CAGGGGGAACAGCAAGACCGGGG - Intronic
1065223981 10:23524230-23524252 CAGGAGCAGGGGCAAGAGCAGGG + Intergenic
1065359078 10:24872220-24872242 CAAGGGCAGTAGCAGGAGCATGG - Intronic
1065991080 10:31011151-31011173 CAGGCTGAGCAGAGAGAGCATGG + Intronic
1066221708 10:33341448-33341470 TAGGGAGAGAAGCAAGAGAATGG - Intergenic
1066431610 10:35357166-35357188 CAGGGGCAGGGGCAGGAGCAGGG - Intronic
1066675701 10:37884788-37884810 CAGGGAAAGCATCAAGTGCAGGG + Intergenic
1066727648 10:38409636-38409658 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
1067324013 10:45249181-45249203 CAGGAAGAGCTGCAGGAGCAGGG - Intergenic
1067799600 10:49349923-49349945 GAGGTGGAGCAGAAAGAGGAAGG + Intergenic
1070183798 10:74040016-74040038 TAGGGGGAGCAGCCAGAAAAAGG - Intronic
1070385163 10:75917630-75917652 CAGGGTGATAAGAAAGAGCAAGG + Intronic
1070710194 10:78675703-78675725 CAGGGAGGGCAGCAGGAGCCAGG - Intergenic
1070778656 10:79125026-79125048 CTGTGGCAGCAGGAAGAGCAAGG + Intronic
1070961472 10:80502919-80502941 GAGGAGGAGGAGGAAGAGCAGGG + Intronic
1071718159 10:88117537-88117559 CTGGGGGAGGAGGAAGAGCACGG + Intergenic
1071777572 10:88806341-88806363 CAGGAGGAGCAAAATGAGCAGGG - Intronic
1072620231 10:97074786-97074808 AAGGAGGGGCAGCCAGAGCAGGG - Intronic
1072996445 10:100249050-100249072 CAGGGGCAGCTGGAGGAGCATGG - Intronic
1073066062 10:100759850-100759872 AAGAGGGAGCACCAAGACCAGGG - Intronic
1073091132 10:100940773-100940795 CAGGGGCAGGAGCAGGGGCAGGG - Intronic
1073152744 10:101323008-101323030 CAGGGAGAGGAGCAGGAGGAGGG + Intergenic
1073260823 10:102188882-102188904 AAGGCCAAGCAGCAAGAGCAGGG + Intergenic
1073480621 10:103784134-103784156 CAGGAGGAGGAGGAAGTGCAGGG + Intronic
1075063044 10:119270016-119270038 CAGAGGGAACAGCAATAGGAAGG - Intronic
1075065836 10:119288299-119288321 CAGGGGGAGGAGAAAGTGGAGGG + Intronic
1075139134 10:119815915-119815937 CACGGGGACCACCAACAGCAAGG - Intronic
1075148045 10:119899998-119900020 CAGGAGGAGAAGCAGGAGGAAGG - Intronic
1075624485 10:123951865-123951887 CAGGAGCAGGACCAAGAGCAAGG + Intergenic
1075663503 10:124214676-124214698 CAGGCAGAGCAGGAAGAGGAGGG + Intergenic
1075852660 10:125601943-125601965 TTGGCAGAGCAGCAAGAGCAGGG - Intronic
1076172918 10:128337884-128337906 CACTGAGAGCAGCAAAAGCATGG + Intergenic
1076218068 10:128711560-128711582 CCGTGGGAGCAGGAAGAGCATGG - Intergenic
1076886396 10:133264746-133264768 CAGAGGCTGCAGCAAGAGCCGGG - Intronic
1076904935 10:133356964-133356986 CAGGGGCAGCAGCTTCAGCACGG + Exonic
1076975280 11:167029-167051 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
1077192603 11:1261729-1261751 CGGGGTGGGCAGCAGGAGCACGG - Exonic
1077235844 11:1481703-1481725 CAGGGGCAGGAGCAGGGGCAGGG + Intronic
1077280433 11:1742538-1742560 CTAGGGGAGCAGCAGGAGGAAGG + Intronic
1078102794 11:8339680-8339702 CAGCGGGGGCTGCAAGAGCTAGG + Intergenic
1078348047 11:10568871-10568893 CTGGGGGAGGAGGAACAGCAGGG - Intronic
1078521816 11:12069558-12069580 GAGGTGGAGCAGCAAGAAGAGGG - Intergenic
1078758892 11:14235913-14235935 CACAGGGAACAGCAAGTGCAAGG + Intronic
1079107018 11:17578291-17578313 CAGGGGCAGCAGCTGGAGGATGG - Intronic
1079787077 11:24686850-24686872 TCGGGGAAGCAGCATGAGCAGGG - Intronic
1080306370 11:30840688-30840710 AAGGGGAAGGAGCCAGAGCAGGG + Intronic
1080635619 11:34120955-34120977 CAGAGGAAGCAGCATGTGCATGG + Intronic
1080975970 11:37340935-37340957 CAAAGGGAACAGCAAAAGCATGG - Intergenic
1082076426 11:47979614-47979636 CAGGAGAAGCCGCAAGAGAAAGG - Intergenic
1082106553 11:48227744-48227766 CAGTGGGAGCAGAAAGATCCAGG - Intergenic
1082243511 11:49893572-49893594 CAGGAGGAGGAGGAGGAGCACGG - Intergenic
1082881407 11:58041529-58041551 CAGGGCAAGGAGAAAGAGCAGGG + Intronic
1082893486 11:58164868-58164890 CAGAGGGAACAGCAAATGCAAGG - Intronic
1083052964 11:59793254-59793276 GAGGGGGAGCTGCAGGTGCAGGG + Intronic
1083811549 11:65109401-65109423 GCGGGAGAGCAGCAGGAGCAGGG - Exonic
1083895775 11:65619031-65619053 CGGGGGGAGCTGCAGGAGGAAGG + Exonic
1084487748 11:69460707-69460729 CAGAGGGTGGAGCAAGAGCCTGG + Intergenic
1084851354 11:71943811-71943833 CAGGAGGAGCAGCATGTGCAAGG + Intronic
1084865495 11:72052876-72052898 AAAGGGGAGCAGCATGATCAGGG + Intronic
1085075974 11:73592625-73592647 AATGGGGAGAAGCAAGAGGAGGG + Intronic
1085310589 11:75514292-75514314 GAGGGGGAGAAGCAGGAGAAGGG + Intronic
1085324888 11:75598956-75598978 CAGGTGGAGAAGCAGGAGAAGGG + Intronic
1085458321 11:76678278-76678300 CAGGTGGAGGAGGAAGAGAAGGG - Intergenic
1085643918 11:78210338-78210360 CAGGCGGAGCAGCAGGGGGATGG - Exonic
1085689915 11:78656488-78656510 CTGGGGGAGCAGTGAGGGCAGGG - Exonic
1085826520 11:79853446-79853468 CTGAGGGAACAGCACGAGCAGGG - Intergenic
1085959266 11:81440480-81440502 CAGGAGGAGTGGGAAGAGCAGGG - Intergenic
1086006809 11:82047475-82047497 CCAGGGGAGCTGTAAGAGCAGGG + Intergenic
1086078880 11:82882122-82882144 CAGGAGGAGGAGAAAGAGGAGGG + Intronic
1086193739 11:84111782-84111804 CATGGGGAACAGCATGAGTACGG + Intronic
1086308485 11:85508362-85508384 CAGAGGGAATAGCAAGTGCAAGG - Intronic
1087133852 11:94694660-94694682 CAGCTGGAGCAGCAGCAGCACGG + Intergenic
1087250216 11:95890537-95890559 AAAGGGGAGCAGAAACAGCAGGG + Intronic
1087515437 11:99154176-99154198 GTGGGGAAGCAGCAGGAGCAGGG + Intronic
1088134462 11:106537450-106537472 CAGAGGGAACAGTATGAGCAGGG - Intergenic
1088691564 11:112333007-112333029 CTGGGGGAGCAGTAGGAGGAAGG - Intergenic
1088902238 11:114127069-114127091 AAGGGGGAACTGCAAGAGCCAGG - Intronic
1089078691 11:115759464-115759486 CAAGGGGAGAAGCTGGAGCAGGG + Intergenic
1089679702 11:120112361-120112383 CAGGGTCAGGAGGAAGAGCAGGG + Exonic
1089778441 11:120855998-120856020 CAGGGGGACCAGGAAAAGGAAGG + Intronic
1090334767 11:125954937-125954959 CAGGGGGAACTGGATGAGCAGGG + Intergenic
1090488823 11:127139842-127139864 CTGGGGGAACATCAAGAGCTAGG + Intergenic
1091179371 11:133589518-133589540 CTGGTGGAGCTGCAAGAACAGGG + Intergenic
1091301499 11:134510764-134510786 CAGGGGCAGCTGGAGGAGCAGGG - Intergenic
1091404745 12:202198-202220 CAGGGGGAAGAGCAGGTGCAGGG - Intronic
1091635624 12:2194372-2194394 GAGGGGGAGCAGGAAGGGGAAGG - Intronic
1091671867 12:2457662-2457684 CAGGGGGCGCAGCACGCGGAAGG - Exonic
1091716165 12:2777645-2777667 TAGAGGGAACAGCATGAGCATGG - Intergenic
1091721998 12:2820565-2820587 CAAGGGTAGCAGCAGGAGGAAGG - Intronic
1091842866 12:3633226-3633248 CAGGGGGAGCAGGAAGACCCAGG + Intronic
1091989093 12:4940173-4940195 CAGAGGGCACAGCAAGTGCAAGG + Intergenic
1092275865 12:7060616-7060638 CAGAGGGAGCTCCAAGATCAAGG + Intronic
1092522112 12:9285832-9285854 CAAGGGGAGCAGCAAGTGCAAGG + Intergenic
1092545170 12:9446024-9446046 CAAGGGGAGCAGCAAGTGCAAGG - Intergenic
1092967228 12:13656038-13656060 CAGGCAGAGAAGCAAGAGAACGG - Intronic
1094213979 12:27921341-27921363 CAGGGGGCCCAGAAATAGCAAGG - Intergenic
1094507777 12:31076025-31076047 CAAGGGGAGCAGCAAGTGCAAGG + Intronic
1094555747 12:31497912-31497934 CAGGGGCAGGGGCAAGGGCAGGG + Intronic
1095508076 12:42919845-42919867 CAGAGGGAGGAACAAGAGCCAGG - Intergenic
1095980986 12:47974722-47974744 CTGGTGGAGCAGCAAGAGCAAGG - Exonic
1095985289 12:47995272-47995294 CAGGGGGACCAGGAGGACCACGG + Exonic
1096114248 12:49046023-49046045 TAGGGGGAGGAGTCAGAGCAGGG - Intronic
1096157552 12:49348964-49348986 CAGGGTCAGCATCCAGAGCAGGG - Exonic
1096231883 12:49901273-49901295 GAGGGGCAGCAGCAGGTGCATGG - Exonic
1096244201 12:49975259-49975281 CAGGGAGGGCAGGGAGAGCAAGG + Intronic
1096543467 12:52321604-52321626 CAGTGGGAGGGGCAGGAGCAAGG - Intergenic
1096748646 12:53744893-53744915 CAGGGGAAGCAGAGAGAGAATGG - Intergenic
1097289620 12:57903647-57903669 CAGCGGGAGCATCAGGAGCTTGG + Intergenic
1098212567 12:68181967-68181989 CAGTGGGTTCAGCAAGAGCTTGG - Intergenic
1098726712 12:73978055-73978077 CAGTGGGCGCAGGAAGCGCAAGG + Intergenic
1099982938 12:89628055-89628077 GAGAGGGAGGAGGAAGAGCAGGG + Intronic
1100559033 12:95728922-95728944 CAGGAGCAGCAGCAAGGGTAGGG - Intronic
1101287161 12:103326627-103326649 CAGAGGGAACAGCAAAAGCATGG - Intronic
1101421405 12:104554318-104554340 CAGAGGGAACAGCATGTGCAAGG + Intronic
1101574322 12:105983451-105983473 CATGGAGAACAGCAAGAGCAAGG + Intergenic
1101580970 12:106040493-106040515 CAGGGTGGGCACCAGGAGCAGGG + Intergenic
1102115693 12:110401541-110401563 CAGGAGGAACAGCAAGTACAAGG + Intronic
1102230363 12:111257620-111257642 AAGAGGGAGGAGGAAGAGCAGGG - Intronic
1102730868 12:115108217-115108239 CAGAGGGAAAAGCAAGTGCAAGG - Intergenic
1103561353 12:121794703-121794725 CAGGGTGAGGAGTAAGAGGAGGG - Intronic
1103568295 12:121828094-121828116 CAGGGGCAGGAGCAGGGGCAGGG - Intronic
1104010826 12:124928920-124928942 CTGTGGGGGCAGCAAGAGAAGGG + Intergenic
1104616394 12:130273472-130273494 AAGGGGGAGGAGAAAGAGAAGGG - Intergenic
1104846615 12:131850289-131850311 CTGGGGGAGCAGCAGGGGCGAGG - Intronic
1104848974 12:131862114-131862136 CAGAGGGAACAGCTAGTGCAAGG + Intergenic
1105486259 13:20835840-20835862 CAGGAGGAGGAGGAAGAGGAGGG - Intronic
1106189746 13:27441080-27441102 GAGGAGGAGGAGCAAGAGGAGGG + Intronic
1106651994 13:31701071-31701093 CAGTAGGAGCAACATGAGCAAGG - Intergenic
1106859835 13:33893918-33893940 GAGGGAGTTCAGCAAGAGCAAGG + Intronic
1109332386 13:60945539-60945561 CAGAGGGAGCAGCTAGTGCAAGG + Intergenic
1110356224 13:74570963-74570985 CAAGGGGAGAAAGAAGAGCAAGG + Intergenic
1111001917 13:82195765-82195787 CAGTAGCAGCAGCAAGAACAGGG - Intergenic
1111405529 13:87799614-87799636 CAGGGAAAGAAGGAAGAGCATGG + Intergenic
1111644733 13:91017722-91017744 AAGGGGCAGCACCAAGAGAAAGG - Intergenic
1112327780 13:98454760-98454782 CAGTGGGAGCTTCAGGAGCAGGG + Intronic
1112676268 13:101705697-101705719 GAGGGGGAGCAGATGGAGCAAGG + Intronic
1113001173 13:105639104-105639126 CAGGAGCAGGAGCAAGAGTAGGG - Intergenic
1113354655 13:109566919-109566941 CAGCAGGAGCAGCAAGAACTAGG - Intergenic
1113795300 13:113053698-113053720 CAAGGGGAGCAGCAGGTGCCTGG + Intronic
1116556023 14:46308519-46308541 CAGGCTGAGTAGCAAGATCATGG - Intergenic
1118485424 14:66210207-66210229 CCTGGGGAGCAGCAAATGCAGGG + Intergenic
1118922973 14:70166933-70166955 GAGGAGGAGCAGCCAGAGGAGGG - Exonic
1119320444 14:73727056-73727078 GAGGGGGAGCCGGCAGAGCAAGG + Intronic
1119525266 14:75317649-75317671 AAGGGAGAGAAGCAAGAACATGG + Intergenic
1119894599 14:78209254-78209276 CAGGTGAAACAGGAAGAGCATGG + Intergenic
1120527581 14:85595044-85595066 GAGGGGGAGGAGGAAGAGGAGGG + Intronic
1120927374 14:89811127-89811149 CAGAGGGAACAGCATGTGCAAGG + Intronic
1121006970 14:90496593-90496615 GAGGGTGCGCAGCAGGAGCAGGG - Intergenic
1121273315 14:92651949-92651971 CAGGGGCGGGGGCAAGAGCAGGG - Exonic
1121517310 14:94561199-94561221 CTCGGGGAGCAGCAAGGGCCAGG + Exonic
1122652398 14:103232709-103232731 CAGTGGGAGCAGCAGGGGGATGG + Intergenic
1122972274 14:105157207-105157229 CAGGGGGAGCAGCCGGGGCTGGG - Intronic
1123068110 14:105628256-105628278 GAGGGGGGGCAGGAGGAGCAGGG - Intergenic
1123115279 14:105891637-105891659 CAGCGGAAGCAGAGAGAGCAGGG - Intergenic
1123117449 14:105901080-105901102 CAGCGGAAGCAGAGAGAGCAGGG - Intergenic
1123699446 15:22903592-22903614 GATGGGGAGCAGCAAGAGCAGGG + Intronic
1124073348 15:26416218-26416240 CAGAAGGAGCAGAAAGAGAATGG + Intergenic
1124202075 15:27687091-27687113 CAGGGGCAGCCGCAAGAGCTGGG + Intergenic
1124475359 15:30028448-30028470 CAGGTGGGGCAGCAACCGCAGGG - Intergenic
1125158247 15:36614216-36614238 CAGAGGGAGGAGCAGCAGCAGGG - Intronic
1126475221 15:49058792-49058814 CAGTGGAAGCAGCAAGGCCAAGG - Intergenic
1126903877 15:53343742-53343764 CATGGTGAGCAGCATGACCAGGG - Intergenic
1127262590 15:57337113-57337135 CTGGAGGAGCAGCATGAACATGG + Intergenic
1127299037 15:57634541-57634563 GAGGTGGGGCAGCAAGAGCAAGG + Intronic
1127386076 15:58468253-58468275 CTGGGGAAGCAGAGAGAGCAAGG - Intronic
1127650957 15:61006600-61006622 CAGAGGAAGGAGCAACAGCATGG - Intronic
1127917424 15:63466762-63466784 CGGGGGAAGCTGCAAGAGAAGGG - Intergenic
1128084837 15:64878679-64878701 CAGGTGGAGAGGCAAGAGAAGGG + Intronic
1128737462 15:70061304-70061326 CAGGGAAAGGAGCAAGGGCAGGG + Intronic
1128926185 15:71658396-71658418 CAGGGGTAGCAGCAACAGACTGG + Intronic
1129183208 15:73889892-73889914 CAGAGGGGCCAGCTAGAGCATGG - Intergenic
1129741558 15:77992063-77992085 CAGCGGCAGCAGCAGGAGCAAGG + Intronic
1130284572 15:82544372-82544394 CAGGGGGTGTACCAAGGGCAAGG - Exonic
1130334657 15:82948701-82948723 CAGGGGAAACAGCAAGTGCAAGG + Intronic
1130485900 15:84398431-84398453 CAGTGGTAGCTGCAAGGGCAGGG - Intergenic
1131105689 15:89732766-89732788 GAGGGGGAGAAGCAAGAGCATGG - Intronic
1131112996 15:89776913-89776935 CAGGGGCAGGGGCAAGGGCAGGG + Exonic
1131569206 15:93516599-93516621 CAGCGGGGACAGCAGGAGCAGGG - Intergenic
1132097406 15:98997978-98998000 CAGGGGGAAAAACAAGTGCATGG - Intronic
1132761617 16:1511217-1511239 CAGGGGCAGCAGCACGTGCCTGG - Intronic
1132972959 16:2697813-2697835 CAGGGGCAGGGGCAAGGGCAGGG + Intronic
1134018611 16:10906605-10906627 GAGGAGCAGCAGCAAGAGCCTGG + Exonic
1134449268 16:14353882-14353904 CAGGGGGAGGAAGAAGAGGAGGG + Intergenic
1134818621 16:17227415-17227437 GAGGAGGAGCAGCAGGAACAAGG + Intronic
1135295730 16:21278009-21278031 AAGGAGGAGCAGGAAGAGGAGGG - Intronic
1135471845 16:22738065-22738087 CAGGCAGAGGAGCAAGAGAAAGG + Intergenic
1135709277 16:24701236-24701258 CAGGGGGAGCTTCAGGAGCTGGG + Intergenic
1136019340 16:27430094-27430116 CTGGAGCAGCAGCAGGAGCAAGG - Exonic
1136073170 16:27801088-27801110 CAGAGAGAACAGCAAGTGCAAGG + Intronic
1136100053 16:27987467-27987489 CAGGGGGCACAGCAGGGGCAGGG - Intronic
1136235056 16:28908640-28908662 CAGGGCTCGCAGCAGGAGCAGGG - Exonic
1137435797 16:48453459-48453481 CAGGGCCAGCTGCAAGGGCAGGG - Intergenic
1137918173 16:52455741-52455763 CAGAGGGAACAGCATGTGCAAGG + Intronic
1137978774 16:53052943-53052965 GAGGAGGAGAAGCAGGAGCAGGG - Intergenic
1138589849 16:57993771-57993793 CAGAGGGAGGAAGAAGAGCATGG + Intergenic
1138658666 16:58504749-58504771 GAGGAGGAGAAGCGAGAGCAGGG - Intronic
1139002093 16:62524443-62524465 CAGAGGGAGTTGCATGAGCATGG + Intergenic
1139750709 16:69107389-69107411 CTGGGGTACCAGGAAGAGCAGGG + Intronic
1140209888 16:72961497-72961519 CAGGAGGAGCAGCAGGGGAATGG - Intronic
1140214388 16:72995651-72995673 CATGGTGTGCAGCAAGAACACGG + Intronic
1140456293 16:75107521-75107543 CAAGGGGAGAAGAAAGAGCCAGG + Intronic
1140591137 16:76354061-76354083 CAAGGTGAGCAGCAAAAGAATGG + Intronic
1141077555 16:81021351-81021373 CAGTGGTAGCAGCAAGTGCCAGG - Intronic
1141267479 16:82509919-82509941 CTTTGGGAGCAGAAAGAGCAAGG - Intergenic
1141694791 16:85614182-85614204 CAGGCGGAGCAGGAAGGGCCGGG - Intronic
1141882195 16:86867492-86867514 GAGAGGGAGCAGAAAGAGCAAGG - Intergenic
1142444980 16:90130630-90130652 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
1142462530 17:104836-104858 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
1142863113 17:2775527-2775549 CAGGGGGAGCAGCAAGTGCAAGG + Intergenic
1143035110 17:3990582-3990604 GAAGGGGAGCAGCGAGGGCAAGG + Intergenic
1143184893 17:5004173-5004195 CAGGGGGAGAAGTAAGACAACGG - Intronic
1143376868 17:6472172-6472194 CAGGGAGAACAGCAGGAGCGAGG - Intronic
1143393885 17:6576704-6576726 CAGGGCCAACAGCAAGAGGAAGG - Intergenic
1143474216 17:7193620-7193642 TTGGGGGAGCAGCAAGTGCTGGG + Intronic
1143724339 17:8835181-8835203 CAGGAGAAGGAGGAAGAGCAGGG + Intronic
1144700151 17:17332283-17332305 CACGCGGAGCAGGAAGGGCAGGG + Intronic
1144810798 17:17997684-17997706 CAGTGGGAGTGGCAAGAGCAGGG - Intronic
1145242699 17:21249014-21249036 CAGGAGGGGCAGAGAGAGCATGG - Intronic
1145276999 17:21437511-21437533 CAGAGGCAGCAGCAGGAGCAGGG - Intergenic
1145773258 17:27508618-27508640 CAGGAGGTGCAGGAAGGGCAGGG + Intronic
1146017655 17:29246873-29246895 CAGGCTGAGCAGCAGGAGCTGGG + Exonic
1146625929 17:34435341-34435363 GAGAGGGAGCAGGAAGGGCAAGG - Intergenic
1147232172 17:39027452-39027474 CTGGGGGAGCAGGAAAACCAGGG - Intergenic
1147987124 17:44313066-44313088 GAGGGGGCTCAGCAAGACCAGGG - Intronic
1148032107 17:44628535-44628557 CAGGGGCAGCGGCAGGGGCAGGG + Intergenic
1148677199 17:49452313-49452335 CAGGGGAAGCAGGAAGGGCAGGG - Intronic
1148795669 17:50195569-50195591 CAGGGCCAGCAGCACCAGCAGGG + Exonic
1148805376 17:50261217-50261239 CAGAGGGAGCAGCATTTGCAAGG + Intergenic
1148895237 17:50835675-50835697 CAGGGAGAGGAGCCACAGCAGGG - Exonic
1149640023 17:58196789-58196811 CGGGGTGAGCAGCATGAGCCTGG + Intronic
1150507542 17:65714990-65715012 CAGGTGGAGCAGAAGGAGCAAGG + Intronic
1151207929 17:72521953-72521975 CAGCCTGGGCAGCAAGAGCAAGG + Intergenic
1151330181 17:73401908-73401930 GGGGGGGGGCAGAAAGAGCAGGG + Intronic
1151423022 17:74011045-74011067 CAGGGGGTGCAGGAAGAACGAGG + Intergenic
1151573530 17:74939385-74939407 CAAGGGCAGCAGCAGGACCAAGG + Intronic
1151755795 17:76074696-76074718 CAGGAGGAGGAGCAAGAGACAGG - Intronic
1151976892 17:77488334-77488356 CAGGGGGAGGAGCACTAGCGGGG + Intronic
1152103453 17:78315842-78315864 CAGGAGGAGGAGGAGGAGCAGGG - Intergenic
1152143054 17:78549841-78549863 CAGGGGCCGCAGCAGGTGCAGGG - Intronic
1152276754 17:79362512-79362534 CAGGGGGAGCAGTGTCAGCAGGG + Intronic
1152325165 17:79631802-79631824 CAGGGGGAGCAGCCTGAGGGTGG - Intergenic
1152344282 17:79742022-79742044 GAAGGGGAGGAGCAGGAGCAGGG - Exonic
1152565192 17:81097244-81097266 CAGGGTGGGCTGCAAGGGCAGGG + Intronic
1152572006 17:81125040-81125062 CAGGGTGAGCAGGGTGAGCAGGG + Intronic
1152588145 17:81198222-81198244 CAGGGGGAGCGCCAAGTCCAGGG - Exonic
1153528067 18:6016212-6016234 CCGGGGGAGCAGCAGGGGCACGG + Intronic
1153732223 18:8025934-8025956 CAGGGAGAGCAGAAGGAGAAAGG + Intronic
1153919878 18:9779033-9779055 GAGGAGGAGCAGGAAGAGGAGGG + Intronic
1154412073 18:14146979-14147001 AATGGGGCGCTGCAAGAGCAAGG + Intergenic
1155297921 18:24402240-24402262 CAGCTGAAGGAGCAAGAGCAGGG + Intergenic
1155751793 18:29433275-29433297 CCTGGGGAGCAGCAAAACCAAGG + Intergenic
1156234182 18:35185212-35185234 TGGGGGGAGCAGGAAGAGCATGG - Intergenic
1156354295 18:36328363-36328385 TGGGGGGAACAGCAAGTGCAAGG + Intronic
1157540260 18:48496649-48496671 CTGGGGGAGGAACCAGAGCATGG + Intergenic
1157738436 18:50071166-50071188 CAGAGGAACCAGCATGAGCAAGG - Intronic
1158471303 18:57739364-57739386 CAGTGGTAGCAGGAAGAGGAGGG - Intronic
1159456782 18:68669366-68669388 CAGGGGGACCAGCGAGTGCAAGG + Intergenic
1160239792 18:77114920-77114942 CAGGGAGAGCAGGAATAGGAAGG - Intronic
1160322535 18:77910011-77910033 CAGAGGGAGTCACAAGAGCATGG - Intergenic
1160394459 18:78561719-78561741 CAGGGGGAGCTGCATGGCCAGGG - Intergenic
1160394465 18:78561737-78561759 CAGGGGGAGCTGCATGGCCAGGG - Intergenic
1160394471 18:78561755-78561777 CAGGGGGAGCTGCATGGCCAGGG - Intergenic
1160411000 18:78675394-78675416 CAGGGGCGGGAGCAAGGGCAGGG + Intergenic
1160481214 18:79241290-79241312 GAGGAGGGGCAGCAAGAGAATGG - Intronic
1160546929 18:79664264-79664286 GAGAGAGAGAAGCAAGAGCAGGG + Intergenic
1160652237 19:237212-237234 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
1160685113 19:430987-431009 CAGGGGGAACAGCCATTGCAAGG - Intronic
1160695135 19:480220-480242 CAGCTGGAGCAGCGTGAGCAAGG + Intergenic
1160771761 19:835227-835249 AAGGGGGAGCAGCAGGGGCTGGG - Intergenic
1161145411 19:2675291-2675313 CAGGAACAGCAGCAAGTGCACGG + Intronic
1162727975 19:12701247-12701269 CAGGGGGAGGAGGAAGGTCATGG + Intronic
1162869319 19:13573516-13573538 CAGATGGAGCAGCAAGAACGGGG + Intronic
1163419372 19:17205647-17205669 CTGGGGGTGCAGCAAGAGTCAGG + Intronic
1163577945 19:18121691-18121713 CAGCGGGAACCGCAAGAGCTTGG + Exonic
1164464518 19:28476086-28476108 CAAGTGGAACAGCAAGTGCAAGG - Intergenic
1164740007 19:30568904-30568926 CAGGAGGAGCAGTAAAAGCAGGG - Intronic
1164742723 19:30588444-30588466 AATGGGGAGAAGCAAGAGGATGG + Intronic
1164886336 19:31781829-31781851 CAGGGAGGGCAGCATGTGCAGGG + Intergenic
1165100229 19:33434796-33434818 CAGGTGGAGCAGCAGAAGCCTGG + Intronic
1165102593 19:33447645-33447667 CAGAGGGAGCTGCGAGAGGACGG + Intronic
1165108875 19:33489731-33489753 CAGGGGCAGGGGCAAGGGCAGGG - Intronic
1165134906 19:33661654-33661676 CAGGGGGAGCCAAAGGAGCAAGG - Intronic
1165695895 19:37900788-37900810 CAGAATGAGCAGCAAGTGCAGGG - Intronic
1165763683 19:38336946-38336968 CAGGGCCAGGAGCAAGAGCAGGG + Intronic
1165763707 19:38337042-38337064 CAGGGCCAGGAGCAAGAGCAGGG + Intronic
1165792933 19:38502804-38502826 CAGGGGGAGGAGCAGGGGCAGGG + Intronic
1165902088 19:39173752-39173774 CAGGGGGCCCAGGAACAGCAGGG - Exonic
1166057895 19:40304302-40304324 CCTGGGGAACAGCAAGGGCAGGG + Intergenic
1166122493 19:40693934-40693956 CAGGGGGAGCAGAGAGGGAATGG - Intronic
1166189551 19:41166911-41166933 CAGAGGGAGCAGGGAGAGCCTGG - Intergenic
1166220269 19:41359865-41359887 CAGGGAGGGGAGCAAGAGCCAGG - Intronic
1166235459 19:41452639-41452661 CAAGAGGAGCAGGAAGGGCAGGG - Intergenic
1166243023 19:41506913-41506935 CAGAGGGAGGAGCAGCAGCAGGG - Intergenic
1166299755 19:41907006-41907028 CAGGGAGAGCAGAGAGAGAAGGG - Intronic
1167581311 19:50344708-50344730 CAGAGGCAGCAGCAGCAGCAAGG + Intronic
1167584424 19:50365574-50365596 CAGAGGCAGCAGCAGCAGCAGGG + Exonic
1167756707 19:51417363-51417385 CGGGGGTAGGAGAAAGAGCAGGG + Exonic
1168651879 19:58097258-58097280 GAGAGGAAGGAGCAAGAGCAGGG + Intronic
1202702625 1_KI270712v1_random:176003-176025 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
925069638 2:956268-956290 CAGGGGGAGGTGCAGGGGCAGGG - Intronic
925132452 2:1503469-1503491 CAGGGGGAGCAGGAGCAGGAGGG + Intronic
926138891 2:10356753-10356775 CTGAGGGAACACCAAGAGCATGG - Intronic
927766116 2:25809887-25809909 CAGAGGGAGGAGCAGCAGCAGGG + Intronic
928600422 2:32898985-32899007 ATGGGGGAGAAGCAAGAGGAGGG - Intergenic
929666572 2:43838502-43838524 CTGGGGGAGCAGCAGCAGCAAGG + Intronic
929924116 2:46195220-46195242 AAGGGGGAGCAGCTAGGGAAGGG + Intergenic
930728933 2:54709359-54709381 CAGAGTGAGCAGCAGGAGCTGGG - Intergenic
930882643 2:56289507-56289529 CAGAGGGAGCAGCATGAGAGAGG + Intronic
931058867 2:58503919-58503941 CAGGGTGAGCAGGGTGAGCAGGG + Intergenic
931248528 2:60510608-60510630 AAGGGGGTGCCACAAGAGCAGGG + Intronic
931431768 2:62214224-62214246 CTGTGGGAACAGCATGAGCAGGG + Intronic
932581272 2:72994100-72994122 CAGGGGGTGCAGCAGGAAAAAGG + Intronic
932610018 2:73191950-73191972 CAGGGGAAGCAGGAGGGGCAGGG + Intergenic
932759250 2:74428738-74428760 CTGGGGGAGGAGGAAGTGCAGGG + Intronic
932834448 2:75023185-75023207 CAGGGGGAGTAGAGGGAGCAAGG + Intergenic
934016183 2:87886190-87886212 CAGCAGGAGGAGCAAGTGCAAGG - Intergenic
934173535 2:89559456-89559478 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
934283849 2:91633809-91633831 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
934878464 2:97950497-97950519 CAGGGGGAGAAGCAAGTGTAGGG - Intronic
935217856 2:100988812-100988834 CAGGGGGACCTGGAGGAGCAGGG - Intronic
937039827 2:118812722-118812744 CAGAGTGAGCAGCAAGATCCTGG - Intergenic
937120704 2:119438362-119438384 GAGGGGGAACAGCGAGAGCTTGG + Exonic
938137397 2:128770464-128770486 CAGGGCCAGCAGGAAGAGCGTGG + Intergenic
938139978 2:128787373-128787395 CAGGAGGTGCAGCAGGCGCAGGG - Intergenic
938286242 2:130120167-130120189 CAGGGGGAGCAGCAAGAGCAAGG - Exonic
938314417 2:130316071-130316093 CAGGGGGAGCAGGAAGCCCAGGG + Intergenic
938429367 2:131218729-131218751 CAGGGGGAGCGGCAAGAGCAAGG + Exonic
938444389 2:131366425-131366447 CTGGGGGAGCAGGGAGAGAATGG - Intergenic
938458830 2:131484585-131484607 CAGCGGCAGCAGCAGCAGCAGGG + Intronic
939076552 2:137609469-137609491 CAGAGGGAACAGCAAGATCAAGG + Intronic
939335290 2:140819083-140819105 ATGGTGGAGCAGCAAGGGCAAGG - Intronic
939793121 2:146605854-146605876 AAGGAGGAGCGGCAAGGGCAAGG - Intergenic
940201197 2:151152802-151152824 CAGAGGGAACAGCAACTGCAAGG - Intergenic
941071206 2:160956495-160956517 CAGGGGGTGGAGCAGGGGCAGGG - Intergenic
942120245 2:172769586-172769608 CCTGGGGAGCAGCAAATGCAGGG - Intronic
942178163 2:173354868-173354890 CAGGAGGAGCAGCAGCAGCGCGG - Exonic
942903424 2:181151518-181151540 CTCCGGAAGCAGCAAGAGCATGG + Intergenic
943051266 2:182916074-182916096 GAGAGGGAGGAGCAGGAGCAGGG - Intronic
943537080 2:189166205-189166227 TATGGAGAGCAGCAAGAGCCTGG - Intronic
944128156 2:196317579-196317601 CAGGGGAAGCTGCAGGAGCGGGG - Intronic
944220758 2:197302054-197302076 CACAGGGAGCAGGAACAGCAAGG + Intronic
944483057 2:200177079-200177101 GAGGGGGAGAAACAGGAGCAAGG - Intergenic
944634197 2:201658923-201658945 CAGAGTGAGCAACAACAGCAGGG - Intronic
946254607 2:218433555-218433577 CAGGGGGCACAGCAAGGACAAGG + Intronic
946385846 2:219384075-219384097 CAGGAAAAGCAGCAGGAGCAAGG + Intronic
947134475 2:226963632-226963654 AAGGGTGAGAAGCAAGGGCATGG - Intronic
947170486 2:227306174-227306196 ATGGGGCAACAGCAAGAGCAAGG + Intronic
947488398 2:230573127-230573149 CAGAGGGAGGAGCAGCAGCAGGG + Intergenic
947904197 2:233747884-233747906 CATAAGGAGCAGAAAGAGCATGG - Intronic
947948220 2:234124765-234124787 CAGGGACAGCAGCAAGAGGCTGG - Intergenic
947955725 2:234189185-234189207 AAGAGGCAGCAGCAAGAGGATGG + Intergenic
948057421 2:235019021-235019043 CAGAGGGAACAGCTAGTGCAAGG + Intronic
948155579 2:235778482-235778504 CTGGGGCAGGAGGAAGAGCACGG - Intronic
948460887 2:238129404-238129426 CAGAGGGAACAGCCAGTGCAAGG + Intronic
948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG + Intergenic
948483311 2:238263979-238264001 GAGGGGGAGGAGGAAGAGGAGGG + Intronic
948599160 2:239098386-239098408 CAGGAGCAGCAGCGAGAGGATGG - Intronic
948845870 2:240682595-240682617 CAGGAAGAGCAGGAAGAGCAGGG + Exonic
948847989 2:240692135-240692157 CAGGAAGAGCAGGAAGAGCAGGG - Exonic
1168756432 20:321618-321640 CAGAGGAAACAGCAAGTGCAAGG - Intergenic
1168976482 20:1969803-1969825 CAGAGAGAAGAGCAAGAGCAAGG - Intergenic
1169001636 20:2172219-2172241 CAGAGGGAGCAGGGAGGGCAAGG - Intronic
1169208383 20:3752532-3752554 CAGGAGGAGCCGCAGGAGGAAGG + Exonic
1169417562 20:5430844-5430866 CAGGGGGAGCTTCCTGAGCAAGG - Intergenic
1169850063 20:10038502-10038524 CAGGGTGAGCACCAAGGTCAAGG - Exonic
1169933537 20:10858692-10858714 CAGTGGAAACTGCAAGAGCAGGG + Intergenic
1170457192 20:16544243-16544265 CAGAAGGACCAGCATGAGCAAGG - Intronic
1170746721 20:19106071-19106093 CCAGGGCAGCAGCATGAGCACGG + Intergenic
1170757543 20:19217792-19217814 CAGTGGGACCAGCAAGCGCCAGG - Intronic
1171283549 20:23920414-23920436 TAGGAGGAGAAGCAAGGGCAGGG + Intergenic
1172132028 20:32662131-32662153 CTTGGGGAGCAGCACGAGCCAGG + Intergenic
1172422497 20:34829079-34829101 CAGGGGGATCAGCATGTGCAAGG - Intergenic
1172623838 20:36336332-36336354 CAGAGGAAACAGCAAGCGCAAGG - Intronic
1172893842 20:38285683-38285705 CAGGAGGAAGAGAAAGAGCAGGG - Intronic
1172992674 20:39047867-39047889 CAGGGGGAGCAGTGAGTGGAAGG + Intergenic
1173162024 20:40659926-40659948 CAGGCGGAGCATGTAGAGCAGGG + Intergenic
1173848519 20:46203012-46203034 GAGGAGGAGCAGCAGCAGCATGG - Intronic
1174050481 20:47764071-47764093 CAGAGGGAGCAGCAAGTTCAAGG - Intronic
1174251872 20:49225982-49226004 CAGAGGGAACAGAAAGTGCAAGG - Intronic
1174286742 20:49479461-49479483 CAGCGGAAACAGCAAGTGCAAGG + Intronic
1174287537 20:49483492-49483514 GAGGGGGAGAAGGAAGAGGAGGG - Intergenic
1174449238 20:50609525-50609547 CAGCAGGGGCAGCAAGAGCTGGG - Intronic
1174476622 20:50800365-50800387 GAGGGGGAGCAGCAGGAGATGGG + Intronic
1174484656 20:50853576-50853598 GAGGGGGATAACCAAGAGCAAGG + Intronic
1174498250 20:50965032-50965054 CAAGGGGAACAGCAAGTGCAAGG + Intergenic
1174603350 20:51742491-51742513 AAGGAGGAGGAGCAACAGCAGGG - Intronic
1175452103 20:59077955-59077977 GAGGGGGAGGAGGAAGAGGAAGG + Intergenic
1176308090 21:5134829-5134851 CTCGGGGAGCTGCTAGAGCAAGG + Intronic
1176379195 21:6103349-6103371 CAGAGGCAGCAGCAGGGGCAGGG + Intergenic
1176379201 21:6103367-6103389 CAGGGGCAGCAGCAGGGGCAGGG + Intergenic
1176379221 21:6103421-6103443 CAGGGGCAGCAGCAGGGGCAGGG + Intergenic
1176379227 21:6103439-6103461 CAGGGGCAGCGGCACGGGCAGGG + Intergenic
1176860960 21:14011348-14011370 AATGGGGCGCTGCAAGAGCAAGG - Intergenic
1176900756 21:14439119-14439141 CAAGAGGATCACCAAGAGCAGGG - Intergenic
1177420428 21:20849696-20849718 CAAGGGCAGAAGCAAGAGAAGGG + Intergenic
1177758314 21:25373705-25373727 GAGGGGGAGTAGGAAGAGGATGG - Intergenic
1178285490 21:31322269-31322291 CAGGAGGAGAAGAAGGAGCAAGG - Intronic
1178883360 21:36465694-36465716 CAGGGGGAGCAGCCCATGCAGGG + Intronic
1179008018 21:37531592-37531614 CTGGGGGCACAGCAAGAACAGGG - Intergenic
1179081771 21:38178297-38178319 CATCTGCAGCAGCAAGAGCAGGG - Intronic
1179500085 21:41803241-41803263 CCGGGTGAGCTGCTAGAGCAAGG + Intronic
1179744246 21:43434798-43434820 CAGGGGCAGCGGCACGGGCAGGG - Intergenic
1179744252 21:43434816-43434838 CAGGGGCAGCAGCAGGGGCAGGG - Intergenic
1179744272 21:43434870-43434892 CAGGGGCAGCAGCAGGGGCAGGG - Intergenic
1179744278 21:43434888-43434910 CAGAGGCAGCAGCAGGGGCAGGG - Intergenic
1179848970 21:44127203-44127225 CTCGGGGAGCTGCTAGAGCAAGG - Intronic
1179915917 21:44478081-44478103 CAGGAGGAGACGGAAGAGCAAGG + Intergenic
1180228906 21:46414596-46414618 CAGGAGGAGGAGGAGGAGCAGGG - Intronic
1180228924 21:46414665-46414687 CAGGAGGAGGAGGAGGAGCAGGG - Intronic
1180228980 21:46414887-46414909 GAGGGGGAGGAGGAAGAGCAGGG - Intronic
1181086152 22:20440357-20440379 GAGGGTGAGGCGCAAGAGCATGG - Intronic
1181348765 22:22240415-22240437 CAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1182086244 22:27563216-27563238 CAGGGGGAATAGCAAATGCAAGG + Intergenic
1182254886 22:29031044-29031066 CAGGGGCAGCGGCAGGAGCGGGG - Intronic
1182370569 22:29807447-29807469 CAGGCTGAGTACCAAGAGCATGG + Intronic
1182482657 22:30619455-30619477 CAGGGTGAGAAGCAAGTGTAAGG - Intronic
1182626182 22:31648221-31648243 CAGGGGACGCAGCAGGAACATGG + Intronic
1183206936 22:36426251-36426273 CAGGGAGAGGAGGAAGAGGAAGG - Intergenic
1183252875 22:36742838-36742860 CAGGGGGAACAGCCTGGGCAAGG + Intergenic
1183270319 22:36858219-36858241 CAGCAGGAGCAGCAAGAGCCCGG + Intergenic
1183353104 22:37344460-37344482 CAGGAGGGGCAGCAAGACCCAGG + Intergenic
1183517424 22:38274891-38274913 CAGAGGGAACAGCTAGTGCAGGG - Intergenic
1183554303 22:38513244-38513266 CAGGGGGAGCAGGGGCAGCAGGG - Intergenic
1184040483 22:41940171-41940193 AAGGAGGAACAGCAAGTGCATGG - Intronic
1184763180 22:46557173-46557195 CAGAGGGAACAGCACGTGCAAGG + Intergenic
1184897657 22:47421049-47421071 CAGGGGAAGCAGCCAGGGAATGG - Intergenic
1185183472 22:49378039-49378061 CATGGGGAGGAGGAAGACCAGGG + Intergenic
1185330593 22:50250552-50250574 CAGGGTCACCAGCAGGAGCAGGG + Intronic
1185348178 22:50319682-50319704 CTGGGGGAGCAGCACGACCGGGG - Intronic
949320898 3:2809340-2809362 CAAGGGGAACAGCAAGGACATGG + Intronic
949944194 3:9177366-9177388 CAGAGGGAGCAGCAAGTTCAAGG + Intronic
950178525 3:10894164-10894186 CAGTGGGAGCAGCAGGACCCAGG - Intronic
950252924 3:11481976-11481998 CAGGAGGAGCCTCAAGGGCAAGG - Intronic
950314305 3:11986984-11987006 AAGGGGAAGAAGCAAGAGAAAGG - Intergenic
950577563 3:13841967-13841989 CAGAGGGAACAGTAAGTGCAAGG + Intronic
950668019 3:14509078-14509100 CAGGGGGCGCTCCAGGAGCAGGG + Intronic
950762339 3:15243151-15243173 CAGAGGGAACAGCAAGTACAAGG + Intronic
950988192 3:17399835-17399857 CAGAGGGAGTAGCTAGGGCAAGG - Intronic
951194534 3:19809169-19809191 CTGGGGGAGCAGCAAATGAAGGG - Intergenic
952879317 3:37973467-37973489 CTGGAGTAGCAGCAAGAGAAGGG - Intronic
953170142 3:40499802-40499824 GAGAAGCAGCAGCAAGAGCATGG - Intergenic
953391222 3:42534989-42535011 CAGGGGGATCAGCAGGAGTGTGG - Exonic
953600589 3:44359962-44359984 CAGAGGCAGCAGCTAGGGCAAGG - Intronic
954304417 3:49717900-49717922 CAGGGCGAGCAGCAAGAGGGTGG + Exonic
954383028 3:50229660-50229682 CAGAGGCAGCAGCAAGTGCAAGG - Intronic
954409611 3:50364723-50364745 CAGGAGGAGCAGCAGTTGCAGGG + Exonic
954808969 3:53236299-53236321 CAGGGGCAGCAGGAAGAGGCTGG + Intronic
954870579 3:53764661-53764683 CAGGGGCAGCGGGAGGAGCAGGG - Intronic
955157697 3:56433435-56433457 GGAAGGGAGCAGCAAGAGCAAGG + Intronic
955317030 3:57947779-57947801 CAGTGGGAACAGCATGTGCAAGG + Intergenic
956160418 3:66345607-66345629 GAGAGGGAGCAGGAAGAGAAGGG - Intronic
956253852 3:67263271-67263293 AAGGAAGAGGAGCAAGAGCAGGG - Intergenic
956508215 3:69965203-69965225 CCGGAGGAGCAGTATGAGCATGG + Exonic
958643181 3:96835459-96835481 CAGAGGGAGTATCAAGTGCAAGG + Intronic
959738417 3:109687644-109687666 AAGGTTGAGCAGAAAGAGCATGG + Intergenic
960168500 3:114431230-114431252 AAGGGTGAGCCTCAAGAGCAAGG + Intronic
961077702 3:123997260-123997282 CAGAGGTAGCAGGAAGAGGAGGG - Intergenic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961306865 3:125964022-125964044 CAGAGGTAGCAGGAAGAGGAGGG + Intergenic
961345539 3:126260957-126260979 GAGGGGGAGAAGGAAGAGGAGGG - Intergenic
961349775 3:126292398-126292420 CGTGGGGAGCAGCAGGAGCTGGG - Intergenic
961370668 3:126427902-126427924 CTGGAGCAGCAGCAAGAGAATGG + Intronic
961492613 3:127265791-127265813 CAGGAGGAGCAGGCACAGCAGGG + Intergenic
961531896 3:127545030-127545052 CTGGGTGAGCAGGAAGAGGAAGG + Intergenic
961534374 3:127560679-127560701 CAGTGGGAACAGGAAGGGCAAGG - Intergenic
961656283 3:128443927-128443949 CAGAGGGAACAGCATGTGCAAGG + Intergenic
961664255 3:128486392-128486414 CAGGGTGGGCAGAAAGATCAGGG + Intronic
961786609 3:129351102-129351124 CAGAGGAAACAGCATGAGCAAGG - Intergenic
962314520 3:134350880-134350902 CAGGGGCAGCAGCAAGGGAAGGG - Intergenic
962752214 3:138441616-138441638 GAGGGGGAGGCGAAAGAGCAAGG - Intronic
963338126 3:144000927-144000949 CAGGGTGAGGAGCAGTAGCAAGG + Intronic
966047888 3:175575311-175575333 CAGGCTGGGCAACAAGAGCAAGG - Intronic
967921733 3:194619130-194619152 CCTGAGCAGCAGCAAGAGCAAGG - Intronic
968131001 3:196192770-196192792 CAGGAGGAGGAGCAAGGGGAAGG + Intergenic
968137244 3:196228227-196228249 CAGGGGCAGCAGCAGCAGCAGGG - Exonic
968365596 3:198182760-198182782 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
968452571 4:682198-682220 GAGGGGGAGCAGGAAGGGCTGGG - Exonic
968897895 4:3415500-3415522 CAGGAGGAGCTGCGAAAGCACGG - Intronic
968983278 4:3862496-3862518 CAGTGGGGGCAGAAAGAGGAGGG - Intergenic
969293147 4:6253242-6253264 CAGAGGGAACAGCAAGTGTAAGG + Intergenic
969511576 4:7620944-7620966 CAGGGGTCGCAGCAGGAGAAGGG - Intronic
969540821 4:7787872-7787894 CTGGGGGAGCCGCGAGAGCCAGG - Intronic
969625005 4:8297889-8297911 CAGGTGGGGCTGCAGGAGCAGGG - Intronic
969672719 4:8598564-8598586 CAGTGGGAGCAGCAGGAACCCGG - Intronic
969827395 4:9768272-9768294 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
969860537 4:10032314-10032336 CAGAAGGAGCAGCAAGGGCCAGG + Intronic
970422485 4:15918526-15918548 CAGAGAGAACAGCATGAGCAAGG - Intergenic
970493669 4:16603381-16603403 CAGAGGGCGCAGCAAGAGAGTGG + Intronic
970518745 4:16861795-16861817 CAGGGGGAACAGCATGTGCAAGG - Intronic
970902830 4:21179276-21179298 CAGAGTGAGCAGAAAGTGCAAGG - Intronic
971313859 4:25550527-25550549 TAGAGGGAACAGCAAGTGCAAGG + Intergenic
971470558 4:27021439-27021461 CAGAGGGAACAGCAAATGCAGGG + Intronic
971586758 4:28414496-28414518 AAGGGGGAGGAGAAAGAGGAAGG - Intergenic
971607800 4:28680930-28680952 CCTGGGGAGCAGCAAATGCAGGG + Intergenic
972573472 4:40330998-40331020 CAGGGTGAGCAGCAGGGGAATGG - Intergenic
972644593 4:40955277-40955299 AAGAGGGAACAGCAAGGGCAAGG + Intronic
972938837 4:44172167-44172189 CAAGGGATGCAGCAAGAACAGGG - Intergenic
975914057 4:79301692-79301714 CATGGGGACCAGCAAGCACAAGG + Intronic
975940504 4:79638921-79638943 CAGAGGGAGCAGCAGGTGCAAGG - Intergenic
976974944 4:91154484-91154506 CAGGAGCAGGAGCAGGAGCAGGG - Intronic
978264754 4:106810353-106810375 GAGGGGGAGGAGGAAGAGGAGGG - Intergenic
979254630 4:118597927-118597949 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
979334331 4:119448104-119448126 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
980701780 4:136441935-136441957 CATGGGGAGGAGGAAGAGCTGGG + Intergenic
980913533 4:139014577-139014599 CAGGGGAATCAGCAAAATCATGG + Intergenic
981637502 4:146897680-146897702 CAGAGGCAGGAGCAATAGCAGGG - Intronic
981750671 4:148090341-148090363 TTGGGGGACCAGCAAGTGCAGGG + Intronic
981803205 4:148681984-148682006 TAGTGGCAGCAGCAACAGCATGG + Intergenic
982317557 4:154047049-154047071 CAGAGGGAGCAGCCCGGGCAAGG + Intergenic
982456253 4:155612321-155612343 CAGCTAGAGCAGCAGGAGCAAGG - Intergenic
985329993 4:188821521-188821543 CAGAGGGAAGAGCAAGAGCACGG + Intergenic
985619186 5:944778-944800 CATGGGGAGCACGAAGAGCATGG - Intergenic
985619200 5:944893-944915 CATGGGGAGCACGAAGAGCATGG - Intergenic
985619218 5:945009-945031 CATGGGGAGCACGAAGAGCATGG - Intergenic
985652269 5:1112528-1112550 GAGGGGGTGCAGAAAGGGCAGGG - Intergenic
985790863 5:1926315-1926337 CAAGGGAAGGGGCAAGAGCAGGG - Intergenic
986178992 5:5376121-5376143 GAGGGTAAACAGCAAGAGCAAGG + Intergenic
986288554 5:6378950-6378972 CATGGTTAGCAGCAAGAGCTAGG - Intergenic
986813166 5:11381527-11381549 CAGGAGGAACAGCAAGTTCAAGG - Intronic
986898588 5:12402874-12402896 CAGGAGGAGAAGAAAGAGAATGG - Intergenic
988578136 5:32445609-32445631 CAGGAAGAGCAGCAAGTGGAAGG + Intergenic
989483726 5:41963725-41963747 AAGGAGGAGCAGGAAGAGGAAGG + Intergenic
989628326 5:43454707-43454729 GAGGGGGAGCTGCAAGATCTAGG - Intronic
989758309 5:44983151-44983173 CAGGAGGATCAGAAAGACCATGG + Intergenic
990502160 5:56407491-56407513 CAGGGAGAGAAGTGAGAGCACGG + Intergenic
991406477 5:66305397-66305419 CAGAGGGAACAGCATGTGCAAGG + Intergenic
991949463 5:71933424-71933446 CAGGGGGAGCCTCCAGACCACGG + Intergenic
991975242 5:72178505-72178527 CAGTGGGAGCTGACAGAGCAGGG + Intronic
993117355 5:83734251-83734273 CATGGAGAGAAGGAAGAGCAGGG - Intergenic
993130830 5:83896244-83896266 CAGAGGGAGCAGAGGGAGCAGGG + Intergenic
993215534 5:85018254-85018276 CAGGAGGAGGAGAAAGAGAAGGG + Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994743459 5:103649473-103649495 TAGAGGGAGCAGCAAGTGGAAGG + Intergenic
994744266 5:103659232-103659254 CAGGGAGAGCAGCAACAGGAAGG + Intergenic
997306362 5:132839825-132839847 GAGGCTGCGCAGCAAGAGCAGGG - Intergenic
997419507 5:133754992-133755014 GAGGAGGAGGAGCAAGAGCTGGG - Intergenic
997435140 5:133868382-133868404 TTGGGGGAGCAGGCAGAGCATGG - Intergenic
997594768 5:135099773-135099795 CAGGGGGAGTGGGAAGAGCCCGG - Intronic
998028002 5:138837467-138837489 GAGGGGGAGGATCAAGAGGAGGG - Intronic
998350356 5:141496355-141496377 CAGGGAGAGAAGCAGGAGCTTGG + Intronic
998430542 5:142066178-142066200 CAGGGGCAGCAGCAGAAGCCAGG + Intergenic
999232186 5:150068239-150068261 CAGGAGCAGCAGCAGCAGCAAGG + Exonic
999430683 5:151522742-151522764 CAGAGGGAGCAGCAAGTGTAAGG + Intronic
999463005 5:151772541-151772563 AAGAGGGAGCAGCGAGTGCACGG + Intronic
999657956 5:153828966-153828988 CAGGAGGAGGGGCAAGTGCAAGG - Intergenic
1001517310 5:172365043-172365065 GAGGGGGAGTGGCCAGAGCATGG - Intronic
1001758120 5:174186301-174186323 CAGAGGGAGCAGGAGGAGCCGGG - Intronic
1001999923 5:176191842-176191864 CTGGGGGTGCAGCATGAGCCGGG - Intergenic
1002212520 5:177607335-177607357 CCTGGAGAGCAGCAACAGCACGG + Exonic
1002398415 5:178976092-178976114 CAGGCGGAGTGGCAAGTGCAAGG - Intergenic
1002664683 5:180814423-180814445 GAGGAGGAGCAGCCAGAGGAGGG - Intronic
1002715852 5:181226711-181226733 CAGGGGGAGGTGAAAGAGAAAGG - Intronic
1003022275 6:2520539-2520561 CAAGAGGAGCAGCATGAACAGGG - Intergenic
1003280871 6:4690327-4690349 CAGGAGGACCACCAAGAGAAAGG + Intergenic
1004020649 6:11773232-11773254 AAGGGGGAGGAGGAAGAGGAGGG + Intronic
1004329876 6:14711603-14711625 CTGAGGGAGCAGGGAGAGCAAGG + Intergenic
1004610133 6:17232136-17232158 CAGAGAGAGCAGCAAGGACAAGG + Intergenic
1005835004 6:29702335-29702357 CAGGAGCAGCAGCAGGAACAAGG + Intergenic
1006149451 6:31978900-31978922 CAGAAGGAGCTTCAAGAGCAGGG + Exonic
1006176743 6:32127143-32127165 CTGAGGGAGGAGGAAGAGCAGGG + Exonic
1006733810 6:36257174-36257196 CCTGGGGAGCAGCAAATGCAGGG - Intronic
1006756674 6:36422323-36422345 CAGAGGGAGCAGCTTGTGCAAGG - Intronic
1007075498 6:39063657-39063679 AAGGAGGAGAAGAAAGAGCAGGG + Intronic
1007172454 6:39873363-39873385 CGAGGGAAGCAGCAAGTGCAGGG - Intronic
1007335820 6:41154256-41154278 CAGGAGCAGCAGCAAGAGCAGGG + Exonic
1007834429 6:44663854-44663876 CAGGAGGGGGAGCAAAAGCAGGG + Intergenic
1008458377 6:51738795-51738817 CAGAGGGAGCAGCCAGGGCAGGG - Intronic
1008827456 6:55714588-55714610 CAGAATGAGCAGCAAGTGCAAGG + Intergenic
1009635479 6:66259643-66259665 CTGGGGGAGCAGCCAGAGAGTGG + Intergenic
1010535113 6:77017227-77017249 CAGAGGAAACAGCAAGAGAAGGG + Intergenic
1011854299 6:91669601-91669623 CAGGAGGAGCAGAAAGAAGAGGG - Intergenic
1014755994 6:125302181-125302203 CAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1015602670 6:134925899-134925921 CAGCGTGAGCAACAAGAGCAAGG + Intronic
1015737335 6:136414841-136414863 CAGCCTGGGCAGCAAGAGCAAGG - Intronic
1016154269 6:140784175-140784197 CAGGGGGTGGAGAAGGAGCATGG + Intergenic
1016387154 6:143539654-143539676 CAGAGGCAGCACCTAGAGCAAGG + Intronic
1016642509 6:146365659-146365681 CAGAGGGGACAGCTAGAGCAAGG - Intronic
1017073190 6:150594673-150594695 AAGGGGGAAGAGAAAGAGCAGGG + Intergenic
1018311364 6:162513150-162513172 CAGAGGAAGCAGCATGACCAAGG + Intronic
1018631951 6:165829218-165829240 CTGGGGGAGCAGCGATATCAGGG - Intronic
1018876233 6:167825806-167825828 CAGGAGGAGCAGCGAGCGCGGGG + Intergenic
1019067899 6:169317910-169317932 AGGAGGGAGGAGCAAGAGCAGGG + Intergenic
1019628648 7:2034802-2034824 CAGAGGTAGCACCAAGAACATGG - Intronic
1019640891 7:2103115-2103137 CAGAGGCAGCAGCAAGCGCAGGG - Intronic
1019959826 7:4449804-4449826 AGGGGGCAGCAGCAGGAGCAGGG - Intergenic
1019969601 7:4529567-4529589 CAGGAGCAGGAGCAAGAGAAAGG + Intergenic
1021482919 7:21137354-21137376 CAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1021603627 7:22389320-22389342 CAGAGGGAACAGTAAGAGAAAGG + Intergenic
1021759106 7:23886032-23886054 CAGGAGGAACAGCAAGTGGAAGG + Intergenic
1023717190 7:43056326-43056348 CAGGGGAAGCATCTGGAGCATGG - Intergenic
1023723080 7:43114552-43114574 CAGAGGAAGCAGCAAGCGGAGGG - Intronic
1023931547 7:44709290-44709312 CAGGGGAAGGACCCAGAGCAGGG - Intergenic
1024069724 7:45775593-45775615 GAAGGGGAGCAGCATGAGCCAGG - Intergenic
1024099068 7:46010704-46010726 CTGGGAGGGCAGCAAGAGAAAGG - Intergenic
1024323883 7:48093775-48093797 CAGGGGGAGCAGCGGGGACAGGG - Intronic
1025835049 7:65086051-65086073 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
1025904822 7:65775530-65775552 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
1026914018 7:74109015-74109037 CCGGGGCATCATCAAGAGCATGG + Exonic
1027247170 7:76375066-76375088 GAGAGGGACCAGGAAGAGCAGGG + Intergenic
1028210339 7:88066741-88066763 CAGAAGCAGCAGCAAGAGAAAGG + Intronic
1029189466 7:98761487-98761509 CAGGGGAAACAGCCAGTGCAAGG + Intergenic
1029694596 7:102204535-102204557 CAGGGCCAGCAGCAAGGGCCAGG + Exonic
1030677952 7:112404552-112404574 CATGAGGAGAAGCAAGAACATGG - Intergenic
1031053789 7:116972128-116972150 CAGAGGGAGGAGCAGCAGCAGGG + Intronic
1031270361 7:119641695-119641717 CAGAAGAAGCAGCAGGAGCAGGG - Intergenic
1032047111 7:128619878-128619900 GAGGGGGAGTAGCATGAGCCGGG - Intergenic
1032462999 7:132125747-132125769 CATGGGGAGAAGCCAGGGCACGG + Exonic
1032523852 7:132564393-132564415 GAGGGGGAGGAGCAAGAAGAGGG - Intronic
1033890439 7:146006416-146006438 CAGGGGGAGGAGAAGGAGCAGGG - Intergenic
1034245523 7:149641426-149641448 CAGGGGCAGCAGGAGAAGCAGGG + Intergenic
1034274638 7:149818663-149818685 CAGGGGGACCAGGAGGACCATGG - Intergenic
1034419859 7:150984237-150984259 CACGGGGTGAAGCAAGAGCTGGG + Intergenic
1034517768 7:151594063-151594085 CTGGTGGAGCAGGAAGAGCCTGG + Intronic
1034533270 7:151710582-151710604 CTGGGAGAGATGCAAGAGCAGGG - Intronic
1035355383 7:158273461-158273483 CAGGGGGAGCCGCAGGCACAGGG + Intronic
1035355389 7:158273479-158273501 CAGGGGGAGCCGCAGGCACAGGG + Intronic
1035355408 7:158273553-158273575 CAGGGGGAGCCGCAGGCACAGGG + Intronic
1035355588 7:158274375-158274397 CAGGGGGAGCCGCAGGCACAGGG + Intronic
1035689297 8:1549275-1549297 CAGCAAGAGGAGCAAGAGCAAGG + Exonic
1036616080 8:10388836-10388858 CAGGGGAAGCAGCAAGCTAATGG - Intronic
1036927697 8:12923183-12923205 CAAGGGCAGCACCAAGAGGATGG + Intergenic
1037101797 8:15055849-15055871 CAGGTGGAGCAGCAAAGGCATGG - Intronic
1037671730 8:21020823-21020845 CAAGGAGAGCAGGCAGAGCACGG - Intergenic
1038159017 8:25019084-25019106 AAAGGGGAACAGCAAAAGCAAGG + Intergenic
1038680963 8:29667624-29667646 CTGGGGCAGCAGCAAGAGCCGGG + Intergenic
1039374938 8:37023861-37023883 CAGGGAGAGCAGAGATAGCAAGG - Intergenic
1039567091 8:38559545-38559567 CAGTGGGAGCACCCAGAGCCAGG - Intergenic
1039884235 8:41646296-41646318 GAGGAGGAGCAGCAGGTGCAGGG - Exonic
1040006834 8:42628132-42628154 CAGGGGGAGCAGAGGGACCAGGG - Intergenic
1040487637 8:47888930-47888952 CAGGAGCAGCTGCAGGAGCACGG + Intronic
1040580488 8:48694961-48694983 CATGGGGAGCTGCCTGAGCAAGG + Intergenic
1040604548 8:48918631-48918653 GAGAGAGAGCTGCAAGAGCATGG - Exonic
1040661544 8:49582133-49582155 CTGGGGGAGCAGCAATGGCTCGG + Intergenic
1041212603 8:55568101-55568123 CAGCAGGAGCACCAAGAGCAAGG - Intergenic
1041258652 8:56001155-56001177 TGGGGAGAGCAGCCAGAGCATGG + Intronic
1041746177 8:61211413-61211435 CAGGAGGAGAAGGAAGAGTAGGG - Intronic
1042903985 8:73754706-73754728 CAAGGGGAGCATCAATAGCGGGG + Intronic
1044798992 8:95933858-95933880 CAGGGTGAGGCGGAAGAGCAAGG - Intergenic
1045016971 8:98008688-98008710 CAGGGGGTGCAGAAAGAGGGTGG + Intronic
1045437629 8:102180015-102180037 CTAGGGGAGGTGCAAGAGCATGG + Intergenic
1045820087 8:106326683-106326705 CAGAGGGACCAGCCAGTGCAAGG + Intronic
1046776010 8:118164114-118164136 GAGGGAGAGCAGCAGGAGGAAGG + Intergenic
1047521524 8:125598810-125598832 CAGAGGCAGCAGCCAGACCAAGG - Intergenic
1048000577 8:130376388-130376410 CAGCTGGAGCAAGAAGAGCATGG + Intronic
1048142266 8:131805944-131805966 GAGGGGGAGGAGAAAGAGAAGGG - Intergenic
1048370723 8:133773932-133773954 CTGGGGCAGCAGGAAGAGCGGGG + Intergenic
1048484226 8:134832150-134832172 CAGGGGGCGCGGCGAGAGCTGGG + Intergenic
1048555999 8:135476558-135476580 CAGAGGGAAAAGCAAGTGCAAGG - Intronic
1048884161 8:138895713-138895735 CAGGGAGAGAAGAAAGAGTACGG + Intronic
1048974338 8:139662636-139662658 CAGGAGCAGCTGGAAGAGCAGGG - Intronic
1048998540 8:139809642-139809664 CAGGGAGAGCAGGAAGATCAGGG - Intronic
1049122018 8:140747640-140747662 AAGGGGGAGGAGGAAGAGGAGGG + Intronic
1049365809 8:142236343-142236365 CAGGTGGGGCAGGAAGAGCCTGG + Intronic
1049382288 8:142323316-142323338 CACGGGGGGCAGCACCAGCATGG + Intronic
1049433039 8:142574095-142574117 CATGGGAAACACCAAGAGCACGG - Intergenic
1049558185 8:143294087-143294109 CAGGAGGGGCAGCAGGAGGAGGG - Intronic
1049566505 8:143341854-143341876 AAGGGGGAGGAGAAAGAGGAAGG - Intronic
1050126331 9:2359951-2359973 CAGGGACAGCAGCAAGACAATGG - Intergenic
1051222870 9:14868924-14868946 CAGGAGGAGCAGCAGCAGCACGG + Exonic
1051745401 9:20290645-20290667 CAGGGTGAGGGGAAAGAGCAGGG + Intergenic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053345280 9:37373536-37373558 CAGGAGGAGCAGCACGTGCAAGG + Intergenic
1055018225 9:71642191-71642213 ATGGGGGAGCAGGAAGAGGAGGG + Intergenic
1055309271 9:74961673-74961695 CTGAGGGAGGGGCAAGAGCATGG + Intergenic
1056132759 9:83601931-83601953 CAGAGAGAGCAGCAAGTGCAAGG + Intergenic
1056502957 9:87228548-87228570 CAGGGGCAGAAGCAAGAGAGAGG - Intergenic
1056722708 9:89085430-89085452 CATGGGGAACTGCGAGAGCACGG - Intronic
1057080766 9:92172914-92172936 CAGGGGCACCAGCAGGTGCAAGG - Intergenic
1057487093 9:95494217-95494239 CAGAGGGAGCAGCCTGGGCAAGG - Intronic
1057593615 9:96395325-96395347 CAGGGGGAGAAACAAGAGGCCGG - Intronic
1057699445 9:97352538-97352560 CCTGGGGAGCAGCAAATGCAGGG - Intronic
1058077580 9:100667013-100667035 CAGAGTGGGCACCAAGAGCAAGG - Intergenic
1058095197 9:100852304-100852326 CAGAGGGAGCAGCACATGCAAGG - Intergenic
1058964317 9:110022469-110022491 GAGGGAGAGCAGGAAGATCAAGG - Intronic
1059104388 9:111499247-111499269 CAGGTGGACTAGCAAGAGAAGGG + Intergenic
1059299002 9:113297927-113297949 CAGGCGGAGCAGGGCGAGCATGG + Exonic
1059326428 9:113506574-113506596 AAGAGGGAGCAGCAAGAGCTGGG - Intronic
1059438079 9:114288452-114288474 CAGGGGGAGCAGGGCGAGGACGG + Exonic
1059438709 9:114290807-114290829 CAGGGGGAGCAGGGAGACGATGG + Exonic
1060718311 9:125955319-125955341 CCTGGGGAGGAGCAGGAGCAAGG - Intronic
1060723282 9:125992160-125992182 CAGGAGGAGCAGCAGAAGCCCGG + Intergenic
1060853181 9:126894499-126894521 CAGAGGGAACAGCACGTGCAAGG + Intergenic
1061390487 9:130314953-130314975 CTGGGGGAGCAGCAGGCGCAGGG + Intronic
1061553292 9:131350216-131350238 CAGAGGGAGCTGCGAGTGCAAGG + Intergenic
1062325627 9:136011160-136011182 CAGGAGGAGCAGGAAGGGCAGGG + Exonic
1062383446 9:136298669-136298691 CAGGAGGAGCCTCAAGAGCCAGG + Intronic
1062597684 9:137306474-137306496 CAGGTGGAGCAGGGAGGGCAGGG - Intergenic
1062749965 9:138245627-138245649 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
1203768189 EBV:37247-37269 CAGGGGGAGGGGCAGGGGCAGGG + Intergenic
1186304416 X:8240099-8240121 GAGGAGGAGGAGGAAGAGCAGGG + Intergenic
1186404207 X:9287466-9287488 CAGTAGGAACAGCAAGAGCAAGG - Intergenic
1186496255 X:10014944-10014966 GAGGGGGAGGAGCAAGCGGAGGG + Intergenic
1187497475 X:19808081-19808103 CAGGGAGAGCTGCAAGAGACAGG - Intronic
1188016980 X:25116748-25116770 CAAGGGGAGCAGAAAGACCATGG + Intergenic
1189162054 X:38819457-38819479 AAAAGAGAGCAGCAAGAGCAAGG - Intergenic
1189173837 X:38934437-38934459 CTGGGAGAGCAGCAATAGGAAGG - Intergenic
1189323122 X:40098002-40098024 GAGGGGGAGGAGGAAGAGGAGGG - Intronic
1190212055 X:48456820-48456842 CAGAGGGAGCAACAGGTGCAAGG - Intergenic
1190335533 X:49259509-49259531 CAGGGGGTGTAGCATGAGCCAGG - Intronic
1190732834 X:53236073-53236095 GAGGGGGAGCAGCGAGAGAGAGG + Intronic
1192134655 X:68585899-68585921 CATGGGGAGCAGGAAGAAGACGG + Intergenic
1194020293 X:88681839-88681861 CAGGGTGAGCTGATAGAGCACGG + Intergenic
1194122837 X:89980611-89980633 CAAAGGGAGCAGACAGAGCATGG + Intergenic
1195517526 X:105794390-105794412 GAGGGGGAGGAGGAAGAGGAGGG + Intergenic
1196021133 X:110992204-110992226 CAGAGAGAACAGGAAGAGCAAGG + Intronic
1196847210 X:119905684-119905706 CAGAGGGAACAGCAAGAGCAAGG - Intronic
1197567416 X:128104605-128104627 CAGAGGGGGCAGAAAGAGAAAGG - Intergenic
1197752246 X:129973213-129973235 CACGAGGAGCAGTAGGAGCATGG - Intergenic
1197922934 X:131614687-131614709 CAGAGGGAACAGCAAGTGCTCGG - Intergenic
1198267318 X:135021913-135021935 CAGGGGCGGCAGCAGGAGCCTGG + Exonic
1198268570 X:135032908-135032930 CAGGGGCGGCAGCAGGAGCCTGG - Exonic
1199128303 X:144152353-144152375 CAGCAGGAGGAGCAAGTGCAAGG + Intergenic
1199217862 X:145281929-145281951 CAGAGGTACCATCAAGAGCAAGG + Intergenic
1199769388 X:150964684-150964706 CAGTGGCAGCAGCAACAGCAAGG + Intergenic
1200310665 X:155073648-155073670 CAAGGAGAGCAGCAAGAGGGTGG - Intronic
1200475696 Y:3638049-3638071 CACAGGGAGCAGACAGAGCATGG + Intergenic
1201306034 Y:12551436-12551458 CAGGAGGAGAAGCTAGAGCAGGG + Intergenic
1201549927 Y:15209215-15209237 AAGGGGGAGCAGGGAGAGGAGGG + Intergenic