ID: 938287126

View in Genome Browser
Species Human (GRCh38)
Location 2:130128085-130128107
Sequence GGCTGCACTCCTTGGGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938287113_938287126 18 Left 938287113 2:130128044-130128066 CCATCCAGGTGCAACTGGCCAGA No data
Right 938287126 2:130128085-130128107 GGCTGCACTCCTTGGGGAGCAGG No data
938287108_938287126 24 Left 938287108 2:130128038-130128060 CCACCCCCATCCAGGTGCAACTG No data
Right 938287126 2:130128085-130128107 GGCTGCACTCCTTGGGGAGCAGG No data
938287114_938287126 14 Left 938287114 2:130128048-130128070 CCAGGTGCAACTGGCCAGAAATT No data
Right 938287126 2:130128085-130128107 GGCTGCACTCCTTGGGGAGCAGG No data
938287110_938287126 21 Left 938287110 2:130128041-130128063 CCCCCATCCAGGTGCAACTGGCC No data
Right 938287126 2:130128085-130128107 GGCTGCACTCCTTGGGGAGCAGG No data
938287117_938287126 0 Left 938287117 2:130128062-130128084 CCAGAAATTGCTGGGCCCACCAG No data
Right 938287126 2:130128085-130128107 GGCTGCACTCCTTGGGGAGCAGG No data
938287111_938287126 20 Left 938287111 2:130128042-130128064 CCCCATCCAGGTGCAACTGGCCA No data
Right 938287126 2:130128085-130128107 GGCTGCACTCCTTGGGGAGCAGG No data
938287112_938287126 19 Left 938287112 2:130128043-130128065 CCCATCCAGGTGCAACTGGCCAG No data
Right 938287126 2:130128085-130128107 GGCTGCACTCCTTGGGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938287126 Original CRISPR GGCTGCACTCCTTGGGGAGC AGG Intronic
No off target data available for this crispr