ID: 938288574

View in Genome Browser
Species Human (GRCh38)
Location 2:130137647-130137669
Sequence GTGGTGCACCGACCTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 2, 1: 3, 2: 1, 3: 3, 4: 70}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938288574_938288578 6 Left 938288574 2:130137647-130137669 CCTTCCTCAGGTCGGTGCACCAC 0: 2
1: 3
2: 1
3: 3
4: 70
Right 938288578 2:130137676-130137698 ACCTCCAGGCAGCCACAGCCTGG 0: 2
1: 0
2: 10
3: 47
4: 375
938288574_938288576 -8 Left 938288574 2:130137647-130137669 CCTTCCTCAGGTCGGTGCACCAC 0: 2
1: 3
2: 1
3: 3
4: 70
Right 938288576 2:130137662-130137684 TGCACCACTGCGTGACCTCCAGG 0: 2
1: 3
2: 1
3: 16
4: 306
938288574_938288582 18 Left 938288574 2:130137647-130137669 CCTTCCTCAGGTCGGTGCACCAC 0: 2
1: 3
2: 1
3: 3
4: 70
Right 938288582 2:130137688-130137710 CCACAGCCTGGAAAAGCACTCGG 0: 2
1: 0
2: 4
3: 113
4: 1937

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938288574 Original CRISPR GTGGTGCACCGACCTGAGGA AGG (reversed) Intergenic
901669446 1:10847074-10847096 ACGGTGCAGCGATCTGAGGAGGG - Intergenic
901761256 1:11473178-11473200 CTGGTGCACCTACCTGTGTACGG - Intergenic
907328395 1:53655822-53655844 GTGGTGCCTCAACCTGAGGTTGG - Intronic
911105032 1:94122960-94122982 GTGGTGCTCATAACTGAGGAGGG + Intergenic
922989843 1:229897201-229897223 GTGGTTAAGTGACCTGAGGAGGG + Intergenic
923448103 1:234091427-234091449 GTGGGACCACGACCTGAGGAGGG + Intronic
1067474493 10:46556812-46556834 GTGGGGACCCGGCCTGAGGAGGG - Intergenic
1070582561 10:77733329-77733351 GAAGTGCACCGACCTGCAGATGG - Intergenic
1076890513 10:133280976-133280998 GTGCTGGACTGAGCTGAGGAAGG + Intronic
1076890570 10:133281170-133281192 GTGCTGGACTGAGCTGAGGAAGG + Intronic
1077503136 11:2918165-2918187 GTGGGGCACAGGCCAGAGGAAGG - Intronic
1083635561 11:64118965-64118987 GTGGTGCATGGAACTGAAGAGGG - Exonic
1084326576 11:68403792-68403814 CAGGTGCCCCGACCTGGGGAAGG + Intronic
1096509566 12:52120172-52120194 GTGGTGCAGCCGCCTGAGGCTGG + Intergenic
1103507605 12:121452516-121452538 GGGGAGCAGCGCCCTGAGGAAGG + Intronic
1105418574 13:20232973-20232995 CTGGTGCACTGTCCCGAGGAAGG - Intergenic
1105782886 13:23719929-23719951 GTGGTGCACAGCCCTGAACATGG + Intergenic
1106067500 13:26369500-26369522 GTGGTGCACTGAACTGAGGTTGG + Intronic
1108108717 13:47043825-47043847 GTGGAGAATCGACCTGAGAAGGG - Intergenic
1113559823 13:111269743-111269765 GTGGTGCAGGGACCTCGGGAGGG - Intronic
1114049658 14:18912910-18912932 GTGGTGCATCGACCTGAGGAAGG + Intergenic
1114112903 14:19489021-19489043 GTGGTGCATCGACCTGAGGAAGG - Intergenic
1118301308 14:64618910-64618932 CTGGGGCACCCAACTGAGGAAGG - Intergenic
1121354960 14:93206792-93206814 GTGCTGCAGTGACCGGAGGACGG - Intronic
1121915300 14:97832744-97832766 AGGGTGCACCCACCTGAGGCTGG - Intergenic
1129130885 15:73494051-73494073 GTGATGCACCTTCCTGAGAAAGG - Intronic
1138190104 16:55007732-55007754 GTGGTGCACAGACCCCAAGATGG + Intergenic
1141473931 16:84259225-84259247 TGGGTGCACAGACCGGAGGAGGG - Intergenic
1142820135 17:2459465-2459487 GTGTTGGACTGACCTCAGGATGG - Intronic
1146757158 17:35442980-35443002 GTGGTAAACAGACCTAAGGAAGG + Intronic
1151598769 17:75093806-75093828 GTGGAGCACAGCCGTGAGGATGG - Exonic
1155066929 18:22276124-22276146 GTGGTGCACAGGCCTGGGAAGGG - Intergenic
1156694892 18:39754099-39754121 GGGGAGCACCGACCTGATGCCGG - Intergenic
1158610302 18:58934539-58934561 GAAGTGCACCGACCTGCAGATGG - Exonic
1159115497 18:64108396-64108418 TCTGTGCACCCACCTGAGGAGGG - Intergenic
1160810216 19:1010052-1010074 GCAGTGAACCGTCCTGAGGATGG - Exonic
1162181428 19:8871641-8871663 GTTCTTCACAGACCTGAGGAGGG + Exonic
1167792684 19:51691090-51691112 CTGGGGTAGCGACCTGAGGAGGG - Intergenic
929552479 2:42903429-42903451 GTGGGGCACTGGCCTGAGCAGGG - Intergenic
932423595 2:71615322-71615344 GAGGTGTACCCACCTGGGGAGGG + Intronic
936895925 2:117427388-117427410 GTGGTGCACTGACCTGCTGTGGG + Intergenic
938288574 2:130137647-130137669 GTGGTGCACCGACCTGAGGAAGG - Intergenic
938320355 2:130358552-130358574 GTGGTTCAGCGACTTGTGGAAGG - Intronic
938427014 2:131201244-131201266 GCGGTGCACTGACCTGAGGAAGG + Intronic
938467958 2:131535287-131535309 GTGGTGCACCGACCTGAGGAAGG + Intergenic
945948027 2:216013220-216013242 GCGGCGCACCCACCTGACGAGGG + Exonic
948433283 2:237934399-237934421 GCTGGGCACAGACCTGAGGATGG - Intergenic
1169642683 20:7772303-7772325 CTGGGCCACCGACCTGGGGATGG + Intergenic
1171459181 20:25289004-25289026 GGGGTGCAGCGTCCTTAGGAGGG + Intronic
1172946475 20:38693328-38693350 GTGGTGCAGGGAGCTGGGGAGGG - Intergenic
1175430795 20:58901642-58901664 GTGGTGCAGTGACCTGTGAAAGG + Intronic
1175766137 20:61594180-61594202 GTGGGGGACTGACCTGAGCAGGG + Intronic
1176049220 20:63107847-63107869 GTGGGGCAGAGAACTGAGGAGGG + Intergenic
1178391753 21:32204652-32204674 GTGATCCACCCACCTGAGGTGGG - Intergenic
1178640016 21:34338032-34338054 GTGGGGCACAGATGTGAGGAGGG + Intergenic
1180033097 21:45225579-45225601 ATTGTGCACAGATCTGAGGATGG + Exonic
1180468137 22:15635285-15635307 GTGGTGCATCGACCTGAGGAAGG + Intergenic
1181108123 22:20586577-20586599 GCGGTGCACCGACTGGAGGAAGG - Exonic
950775263 3:15344229-15344251 GTGGTGCACAAAACTGAAGATGG + Intergenic
952802266 3:37306114-37306136 GTGGTGTACCGATTTCAGGATGG + Intronic
954390386 3:50265386-50265408 GTGGGACACCCATCTGAGGAAGG - Intergenic
957040913 3:75334903-75334925 GTGGTGCCACATCCTGAGGATGG - Intergenic
972982753 4:44726039-44726061 GTGTGGGACCGACCCGAGGAGGG + Intronic
976849572 4:89529678-89529700 GTGGTGCTCCTACCAGAAGAAGG - Intergenic
983820993 4:172193271-172193293 GAGGGGCACCGACCTGATGCTGG - Intronic
996729710 5:126705282-126705304 TTGGTGAACTGAACTGAGGAAGG - Intergenic
1006913287 6:37578227-37578249 GTGGAGCACAGACCTGAAGGAGG + Intergenic
1010196849 6:73248172-73248194 GTGGGAGACAGACCTGAGGAGGG + Intronic
1020867938 7:13590530-13590552 GTGGAGCACCAACCTGATGCTGG + Intergenic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1035828031 8:2665256-2665278 AAGGTGCACCGCCCTGAGGTCGG - Intergenic
1035911896 8:3576431-3576453 GTGGTACACAGTGCTGAGGAGGG - Intronic
1042216343 8:66432476-66432498 GCGGTGTAGCGACCCGAGGAGGG + Exonic
1043404025 8:79912376-79912398 GTGGTGTACAGATCTGAGGGTGG + Intergenic
1057961861 9:99464820-99464842 GAGGTCCACCGCCCTGAGCATGG - Intergenic
1059984437 9:119808405-119808427 GTGGTGCATCGAGCAAAGGAAGG + Intergenic
1060786058 9:126452367-126452389 GTGCTGGTCCGAGCTGAGGAGGG - Intronic
1061190841 9:129081692-129081714 GTGGTGCCACGCCCTGAGCAGGG + Intronic
1199308157 X:146292273-146292295 GAGGGGCACCGACCTGATGCTGG + Intergenic