ID: 938290798

View in Genome Browser
Species Human (GRCh38)
Location 2:130149147-130149169
Sequence CATGCCCATCTGAGGTTTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 180}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938290794_938290798 12 Left 938290794 2:130149112-130149134 CCTAAACACATGCAGTGTGTTTA 0: 2
1: 0
2: 2
3: 26
4: 203
Right 938290798 2:130149147-130149169 CATGCCCATCTGAGGTTTTTGGG 0: 1
1: 1
2: 0
3: 11
4: 180
938290792_938290798 24 Left 938290792 2:130149100-130149122 CCCTTGGGAGTTCCTAAACACAT 0: 2
1: 0
2: 0
3: 6
4: 115
Right 938290798 2:130149147-130149169 CATGCCCATCTGAGGTTTTTGGG 0: 1
1: 1
2: 0
3: 11
4: 180
938290793_938290798 23 Left 938290793 2:130149101-130149123 CCTTGGGAGTTCCTAAACACATG 0: 2
1: 0
2: 1
3: 12
4: 136
Right 938290798 2:130149147-130149169 CATGCCCATCTGAGGTTTTTGGG 0: 1
1: 1
2: 0
3: 11
4: 180
938290791_938290798 29 Left 938290791 2:130149095-130149117 CCTTACCCTTGGGAGTTCCTAAA 0: 2
1: 0
2: 0
3: 7
4: 90
Right 938290798 2:130149147-130149169 CATGCCCATCTGAGGTTTTTGGG 0: 1
1: 1
2: 0
3: 11
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938290798 Original CRISPR CATGCCCATCTGAGGTTTTT GGG Intergenic
903184487 1:21621709-21621731 CATGCCCAGCTGAGGTTGTGTGG - Intronic
903594529 1:24484128-24484150 CATCCCCATCTTCTGTTTTTTGG + Intergenic
905912396 1:41663197-41663219 GATGCCCACCAGAGGTTATTTGG + Intronic
906216629 1:44044761-44044783 AATACCCATCTAAGGTTGTTGGG + Intergenic
906359070 1:45137218-45137240 CATGCCCAGCTAATTTTTTTAGG + Intronic
906420006 1:45657694-45657716 CATGCCCAGCTAACTTTTTTGGG - Intronic
907272999 1:53301572-53301594 CATGCCCAGCTAATTTTTTTTGG - Intronic
910006793 1:82407064-82407086 CATGCCCAGCTAATATTTTTTGG - Intergenic
910862256 1:91753231-91753253 CATGACCAGCTGATTTTTTTTGG - Intronic
910955718 1:92702270-92702292 CTTGCCAATTTTAGGTTTTTTGG - Intronic
911017751 1:93352403-93352425 AATGCCTTTCTGAAGTTTTTAGG + Intronic
913017165 1:114750340-114750362 CATGCTCATCTGATGTTATTTGG + Intronic
913263455 1:117022166-117022188 CAATCCAATCTGAGGTTTTGGGG + Intronic
915318484 1:155043040-155043062 CCTGCCCATCTCAGGTGTTCGGG - Intronic
915318676 1:155044024-155044046 CCTGCCCATCTCAGGTGTTTGGG - Intronic
915393625 1:155565138-155565160 CATGCCCACCTGATTTTTTTTGG - Intergenic
916515523 1:165512972-165512994 CCTGCCCTTGTGAGTTTTTTAGG - Intergenic
916518417 1:165541557-165541579 CATGCCCAGCTAATTTTTTTTGG - Intergenic
920089709 1:203443543-203443565 CATGACTATCTGAGGGTTTCTGG - Intergenic
920317893 1:205092281-205092303 AATGCCCCTTTGAGGTTTTTGGG + Intronic
922255307 1:223888491-223888513 CAAGCCCTTCAGAGGTATTTGGG + Intergenic
1065069529 10:22008180-22008202 CATGCCCAGCTAATTTTTTTTGG - Intergenic
1068010230 10:51439534-51439556 AATACCAAGCTGAGGTTTTTAGG - Intronic
1070049903 10:72878272-72878294 CATGCCCAGCTAGGATTTTTTGG + Intronic
1070934625 10:80283687-80283709 CATGCCCATCTGTTGTTGATTGG - Intronic
1072706764 10:97686783-97686805 CATCCCCATTTGAGGTCTGTCGG - Exonic
1074292901 10:112154205-112154227 CATGCTCATCAGAGCATTTTGGG + Intronic
1077870012 11:6253806-6253828 CATGTCCAGCTGAGATTTTATGG + Intergenic
1080760063 11:35240124-35240146 CATGCCTGTCTCAGCTTTTTCGG - Intergenic
1081170911 11:39869159-39869181 CATGCCCAGCTAAGTTTTGTGGG - Intergenic
1081341891 11:41938108-41938130 CATGACCATGTGAGGTAGTTAGG - Intergenic
1083907224 11:65680975-65680997 CATGCCCAGCTAATTTTTTTTGG + Intergenic
1085288116 11:75377375-75377397 CATGCCCAGCTAATTTTTTTTGG - Intergenic
1087508035 11:99053469-99053491 CATTCACATCTGAGGTTTCTTGG + Intronic
1089028403 11:115296105-115296127 CATGCCCAGCTAATATTTTTTGG + Intronic
1092367882 12:7892073-7892095 CATGCCCATCTTGTGTGTTTGGG - Intergenic
1094106691 12:26819912-26819934 CATGCCCAGCTAATTTTTTTGGG - Intronic
1097690868 12:62733409-62733431 CATACCCAGCTGATTTTTTTTGG + Intronic
1097707996 12:62887964-62887986 CATGCCCTTCTGTGGCTTCTAGG - Intronic
1097876941 12:64652336-64652358 CATGGCCATCGCAGGTGTTTGGG + Intronic
1102168316 12:110823420-110823442 CATAACTATGTGAGGTTTTTTGG - Intergenic
1105009974 12:132749150-132749172 CACGCCCAGCTGATTTTTTTGGG + Intronic
1106466881 13:30021337-30021359 CTTGCCCATCTGCGGTTCTGGGG + Intergenic
1106537618 13:30661595-30661617 AATGCACATTTAAGGTTTTTTGG + Intergenic
1110378930 13:74827173-74827195 GATGCAAATCAGAGGTTTTTGGG - Intergenic
1110419190 13:75286207-75286229 CATGCTCCTGTGAGTTTTTTGGG - Exonic
1112291887 13:98151308-98151330 CAGCGCCATCTGCGGTTTTTAGG + Intronic
1112594424 13:100794934-100794956 CAGTCCCATCTGGGGTTTTTAGG - Intergenic
1113216779 13:108050442-108050464 CATGCCCATCACAGATATTTAGG - Intergenic
1114416496 14:22548329-22548351 CATTCCAATCTGAAGTTATTTGG - Intergenic
1115355655 14:32443816-32443838 GCTGCCCATCTATGGTTTTTCGG + Intronic
1118569806 14:67183000-67183022 CATGCCCAGCTGATGCTATTGGG + Intergenic
1118922294 14:70160511-70160533 CTTGAGCATCTGAGGATTTTTGG + Intronic
1122008212 14:98723528-98723550 CATGCCCATCAAAGGGTGTTGGG + Intergenic
1123583204 15:21735138-21735160 CATGCACAAATGAGTTTTTTTGG + Intergenic
1123619854 15:22177735-22177757 CATGCACAAATGAGTTTTTTTGG + Intergenic
1125278560 15:38019903-38019925 CATGCCCAGCTGTGGTTCTATGG + Intergenic
1126321707 15:47430908-47430930 CATGACCATCTGAGTTTTGCTGG - Intronic
1128744561 15:70104264-70104286 CATGCCCACCTGAGACTTTGTGG + Intergenic
1129083257 15:73060801-73060823 CATGCCCAGCTAATTTTTTTGGG + Intronic
1130940897 15:88508099-88508121 CATTCCCATCTGGGGGTGTTGGG - Intergenic
1132827099 16:1910566-1910588 CATGCCCAGCTAATTTTTTTTGG - Intergenic
1133122983 16:3623050-3623072 CATGCCCAGCTAATTTTTTTGGG - Intronic
1133157793 16:3887978-3888000 CATGCCCAGCTAATTTTTTTTGG + Intergenic
1133695485 16:8258677-8258699 CAAGCCCATATCATGTTTTTTGG + Intergenic
1135202392 16:20449775-20449797 CATTTCTATCTGAGATTTTTTGG - Intergenic
1135216712 16:20578091-20578113 CATTTCTATCTGAGATTTTTTGG + Intergenic
1136263980 16:29103308-29103330 CATGACCATCTGGGGTTGTCTGG + Intergenic
1140102459 16:71929591-71929613 CTTGCTCAGATGAGGTTTTTTGG + Exonic
1141106389 16:81237219-81237241 CATGCCCAGCTAATTTTTTTTGG + Intergenic
1144483355 17:15645403-15645425 CAGGCAAACCTGAGGTTTTTGGG - Intronic
1144526397 17:15994103-15994125 CATGCCCAGCTAATTTTTTTTGG + Intronic
1144915333 17:18719623-18719645 CAGGCAAACCTGAGGTTTTTGGG + Intronic
1145237550 17:21219461-21219483 CATGCCCAGCTAACTTTTTTTGG - Intergenic
1147386726 17:40086924-40086946 CAGGCTCATCTGAGGTTCTCTGG + Intronic
1151255748 17:72875007-72875029 TTTGCCCATCTGAGTGTTTTTGG - Intronic
1151487616 17:74411210-74411232 CATGACAATTTGAGTTTTTTGGG + Intergenic
1153962124 18:10148776-10148798 CATTTCCATCTGAGGTGGTTTGG + Intergenic
1158568454 18:58575598-58575620 CCTGCCCATCTTAAGTTTCTCGG - Intronic
1160444020 18:78913451-78913473 TTTCCCCATCTGTGGTTTTTGGG - Intergenic
1162460943 19:10813667-10813689 CATGCCCAGCTAATTTTTTTTGG - Intronic
1162923249 19:13916271-13916293 CACACCCAGCTGAGCTTTTTGGG - Intronic
1164231017 19:23288909-23288931 TATGCCCACATGAGGTTTTTGGG - Intergenic
1165259002 19:34597269-34597291 CATGCCCACCTGAGGTTACCTGG + Intronic
1167083426 19:47292793-47292815 CAAGCCCAACTGAGATATTTGGG + Intronic
1168045412 19:53790767-53790789 CATGCCCAGCTAATTTTTTTTGG + Intergenic
925156745 2:1654228-1654250 CATGGGCATCTGAGTTTTCTGGG - Intronic
925536769 2:4926541-4926563 CATGCCCGGCTAATGTTTTTTGG + Intergenic
925655926 2:6149286-6149308 AATGCACAAATGAGGTTTTTAGG - Intergenic
927018609 2:18994900-18994922 CAAGCCCTTCAGAGGATTTTGGG + Intergenic
929305790 2:40360081-40360103 CATGACCTTGTAAGGTTTTTGGG - Intronic
930064330 2:47316204-47316226 CATGCCCTTCTGAAGTGTCTAGG + Intergenic
931649047 2:64452539-64452561 AATGCCTATCTCAGGTTATTGGG - Intergenic
931766590 2:65462241-65462263 CATGCCCAGCTAGGTTTTTTTGG - Intergenic
932915553 2:75854657-75854679 CTTGCCCATCTGATATGTTTTGG + Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
938290798 2:130149147-130149169 CATGCCCATCTGAGGTTTTTGGG + Intergenic
938465751 2:131523806-131523828 CATGCCCATCTGAGGTTTTCGGG - Intergenic
940188453 2:151012465-151012487 CATGCCCAGCTGAAGGTTCTGGG - Intronic
940302452 2:152189526-152189548 CATGCCTAGCTGAAGGTTTTTGG - Intergenic
940688219 2:156881085-156881107 TATGCCCAGATGAGGTATTTTGG - Intergenic
942551907 2:177128549-177128571 CATCCCAATCTGTGCTTTTTTGG - Intergenic
948360918 2:237419544-237419566 CATGTCCATATGAAGTGTTTAGG - Intergenic
948734153 2:239988582-239988604 CATTCCCACCTGAGCTTGTTCGG - Intronic
1169114002 20:3051056-3051078 CCTGCCTGTCTCAGGTTTTTGGG - Intergenic
1169346684 20:4834488-4834510 CATGCCCTTCTCAGGGTTATGGG - Intergenic
1169778935 20:9288035-9288057 CAAGCTCACCTGAGGTTTCTTGG + Intronic
1172347857 20:34218281-34218303 CATTCCAATCTGAGGATTTGTGG - Intronic
1173460889 20:43242659-43242681 CATGCCCTTCTGAGGTCATGAGG - Intergenic
1174009987 20:47442003-47442025 CATGCCCAGCTAACTTTTTTAGG + Intergenic
1174214266 20:48904079-48904101 CATGCCCAACTAATTTTTTTTGG - Intergenic
1174486981 20:50867501-50867523 CATGCCCAGCTAATTTTTTTGGG + Intronic
1174680373 20:52400681-52400703 CATGCCCATCCGAAGTTGTTAGG - Intergenic
1178362798 21:31963651-31963673 CATGCCCAGCTAATTTTTTTTGG + Intronic
1178711718 21:34923042-34923064 AATGACCATCTGTAGTTTTTTGG - Intronic
1179991892 21:44952616-44952638 CACGCCCAGCAGAGGTCTTTTGG + Intronic
1184337268 22:43861398-43861420 GTACCCCATCTGAGGTTTTTAGG - Intronic
954054481 3:48010200-48010222 CATGACCTGCTGAGGTATTTGGG + Intronic
955163753 3:56490382-56490404 AATGGACTTCTGAGGTTTTTTGG + Intergenic
955672038 3:61412171-61412193 CATGCCCAGCTAATTTTTTTTGG - Intergenic
956319786 3:67984113-67984135 CATGCCTACCTGAGGTACTTAGG + Intergenic
960331641 3:116367035-116367057 CATGCCAATTAGAAGTTTTTGGG - Intronic
963787000 3:149545106-149545128 AATACTCATCTCAGGTTTTTTGG - Intronic
964099718 3:152974282-152974304 CATCCCCAACTGTTGTTTTTTGG + Intergenic
966856968 3:184201051-184201073 CATGCCCATCTGTCCTTTTAAGG + Intronic
969831997 4:9805346-9805368 CATGCCCATCTGTGTTTCATTGG + Intronic
971360746 4:25936349-25936371 CATGCCCAGCTAACTTTTTTTGG - Intergenic
974552601 4:63397456-63397478 CACCCCCATCTGTTGTTTTTTGG + Intergenic
976523914 4:86064030-86064052 CATGGACATCTAAGGTTTGTAGG + Intronic
978528157 4:109687200-109687222 CATGCCCACCTAATATTTTTTGG - Intronic
978764790 4:112392986-112393008 CATGTCCATCTGAGGTCAGTAGG + Intronic
979446812 4:120823658-120823680 CTTGTCAATCTGAGGTTTGTAGG - Intronic
982977007 4:162076574-162076596 GATTACCATCTGAGGTTATTTGG + Intronic
983474543 4:168197616-168197638 CATGCCCAGCTAATTTTTTTTGG - Intergenic
984055212 4:174919892-174919914 CATGCACATCTGGGCATTTTAGG + Intronic
984559810 4:181254974-181254996 CATGCCCAGCTAAGGGTTTAGGG + Intergenic
987943388 5:24571842-24571864 CATGCCCAGCTGAGGTCATGGGG - Intronic
993381288 5:87211491-87211513 CATCCCAATCTGAGGTTTCTAGG - Intergenic
997329015 5:133045655-133045677 CATGCCCAGCTAATTTTTTTGGG - Intergenic
1000852414 5:166356609-166356631 CATGCCCATCTGCTGTTCCTGGG - Intergenic
1001598346 5:172912923-172912945 CATGCCCAGCTAATGTTTTGTGG + Intronic
1002150601 5:177226609-177226631 CATGCCCAGCTTAGGTCATTTGG + Intronic
1007586514 6:42993556-42993578 CATGTCCTTCTGAGGTTCTAAGG + Intronic
1012001016 6:93655324-93655346 TAAGCCCAACTTAGGTTTTTTGG + Intergenic
1016961993 6:149682566-149682588 CATGCCCAGCTAATTTTTTTTGG + Intronic
1019423051 7:960101-960123 CATGCCCAGCTAAGTTTTGTGGG + Intronic
1022221923 7:28322136-28322158 AATGCCCATCTAATGCTTTTGGG - Intronic
1022524376 7:31027965-31027987 CATGCCCACCTGAGGATCATGGG + Intergenic
1023912512 7:44565992-44566014 CAAGCCCTCCTGAGGTTGTTGGG - Exonic
1024420668 7:49162064-49162086 CATGGTTATCTGAGGTTTTATGG - Intergenic
1025959425 7:66206660-66206682 CATCCCCATCTGCAGTGTTTGGG + Intronic
1029005762 7:97207402-97207424 CATGCCTATCTCAGTATTTTGGG - Intergenic
1029481361 7:100815164-100815186 CATGCCCAGCTAATTTTTTTTGG - Intronic
1030224845 7:107138838-107138860 CATGCCCAGCTTATTTTTTTTGG + Intronic
1031254308 7:119428402-119428424 CATTCCAATCTGTGGATTTTGGG + Intergenic
1032376822 7:131428012-131428034 CATGCCCAGCTAACTTTTTTTGG - Intronic
1033101168 7:138473581-138473603 GATGCCAATCTAAGTTTTTTTGG - Intronic
1034076202 7:148233746-148233768 TATTCCCATCTGATGTGTTTTGG + Intronic
1038147971 8:24915270-24915292 CATTCCCATCTGAGCCCTTTGGG - Intronic
1038861328 8:31392038-31392060 CATCCCGGTCTCAGGTTTTTTGG - Intergenic
1041574200 8:59374912-59374934 TGTGCCCATCTGAGGATATTAGG + Intergenic
1042372943 8:68013375-68013397 CATTCCAATCTGAGGTTCTAAGG - Intronic
1047791622 8:128209519-128209541 CATGCCCAGCTAATTTTTTTTGG + Intergenic
1048306738 8:133289791-133289813 GCTGCCCCACTGAGGTTTTTGGG - Intronic
1048379933 8:133856627-133856649 CATGCCCATGGGAGACTTTTGGG + Intergenic
1050517997 9:6465661-6465683 CATTCTCATCAGAGGTTTATCGG + Intronic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053184348 9:36002832-36002854 CATGCTCTTCTGAGATTTGTGGG + Intergenic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1056632748 9:88307185-88307207 CATGGCCATCTGATCTTGTTGGG + Intergenic
1057883347 9:98809141-98809163 CATGCTGATCTCAGGATTTTAGG + Intronic
1058365896 9:104207866-104207888 TATGCCCAGGTGTGGTTTTTTGG - Intergenic
1062247416 9:135576266-135576288 AATGCTCATCTGTGGCTTTTGGG + Intergenic
1185573848 X:1154743-1154765 CACGCCCGGCTGATGTTTTTAGG + Intergenic
1186006526 X:5078258-5078280 GATGCCCATGTGTGGTTTATAGG + Intergenic
1188952428 X:36392723-36392745 AATTCCCATCTAAGGTTTTATGG - Intergenic
1189275476 X:39782130-39782152 CAAGCCCAGCTAATGTTTTTTGG + Intergenic
1189911869 X:45818120-45818142 CATGCCCACCTGATTTTTTTAGG - Intergenic
1190502236 X:51090773-51090795 CATGCACAGGTAAGGTTTTTGGG + Intergenic
1193913861 X:87341380-87341402 CATGCCCAGCTAATATTTTTGGG - Intergenic
1195915449 X:109930895-109930917 CATGCCCATTTGAGGTCTACAGG - Intergenic
1196225804 X:113165212-113165234 CATTTCCATCTGAAGTTTTCAGG - Intergenic
1198307584 X:135398354-135398376 AATTCCCATTTCAGGTTTTTTGG - Intergenic
1198838956 X:140835649-140835671 CATTCCCTTCTCAGGCTTTTGGG - Intergenic
1199583004 X:149379186-149379208 CATTCTCATCTGAGCTTTATGGG - Intergenic
1200981293 Y:9265407-9265429 CTTGCCCCTCTGATATTTTTAGG - Intergenic
1201587924 Y:15581786-15581808 CATGCCCAGCTAATTTTTTTAGG + Intergenic
1202129127 Y:21594327-21594349 CTTGCCCCTCTGATATTTTTAGG + Intergenic