ID: 938292013

View in Genome Browser
Species Human (GRCh38)
Location 2:130155490-130155512
Sequence GAGGCCCCTTTCCAAGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938292009_938292013 -4 Left 938292009 2:130155471-130155493 CCACATCCTTAGCAAGGCTGAGG No data
Right 938292013 2:130155490-130155512 GAGGCCCCTTTCCAAGTGGATGG No data
938292011_938292013 -10 Left 938292011 2:130155477-130155499 CCTTAGCAAGGCTGAGGCCCCTT No data
Right 938292013 2:130155490-130155512 GAGGCCCCTTTCCAAGTGGATGG No data
938292006_938292013 9 Left 938292006 2:130155458-130155480 CCCTCTGAGGATGCCACATCCTT 0: 1
1: 1
2: 3
3: 12
4: 184
Right 938292013 2:130155490-130155512 GAGGCCCCTTTCCAAGTGGATGG No data
938292007_938292013 8 Left 938292007 2:130155459-130155481 CCTCTGAGGATGCCACATCCTTA 0: 1
1: 1
2: 0
3: 25
4: 152
Right 938292013 2:130155490-130155512 GAGGCCCCTTTCCAAGTGGATGG No data
938292004_938292013 15 Left 938292004 2:130155452-130155474 CCCAGGCCCTCTGAGGATGCCAC 0: 1
1: 1
2: 2
3: 20
4: 236
Right 938292013 2:130155490-130155512 GAGGCCCCTTTCCAAGTGGATGG No data
938292005_938292013 14 Left 938292005 2:130155453-130155475 CCAGGCCCTCTGAGGATGCCACA 0: 1
1: 1
2: 2
3: 29
4: 257
Right 938292013 2:130155490-130155512 GAGGCCCCTTTCCAAGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938292013 Original CRISPR GAGGCCCCTTTCCAAGTGGA TGG Intronic
No off target data available for this crispr