ID: 938292437

View in Genome Browser
Species Human (GRCh38)
Location 2:130157253-130157275
Sequence TTTGAACTCCTCCAGGGGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 2, 1: 0, 2: 4, 3: 13, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938292428_938292437 -4 Left 938292428 2:130157234-130157256 CCGCAAGGGCCACCCACCGTTTG 0: 2
1: 1
2: 1
3: 7
4: 68
Right 938292437 2:130157253-130157275 TTTGAACTCCTCCAGGGGGCTGG 0: 2
1: 0
2: 4
3: 13
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938292437 Original CRISPR TTTGAACTCCTCCAGGGGGC TGG Exonic
901430190 1:9209470-9209492 TTAGAAGTCCCCCAGTGGGCCGG - Intergenic
904961888 1:34339928-34339950 TTGGAACTCCTCCAGGGCATTGG + Intergenic
905452034 1:38063102-38063124 TTTGCACTGCTCCAGGGGCAGGG + Intergenic
906345022 1:45009672-45009694 GTTGAACTCCTCCTGGGGAGGGG + Exonic
907867253 1:58410178-58410200 TTTCAATTCCTTCATGGGGCTGG - Intronic
908519619 1:64928533-64928555 TTAGGACTCCTGGAGGGGGCAGG - Intronic
912559398 1:110539169-110539191 TGTGAGCTCCTCCAGGATGCCGG + Intergenic
918068847 1:181120356-181120378 TTTGAACTCATCCTGCTGGCAGG + Intergenic
919610810 1:199743597-199743619 TTTTAACTCCTTCTGGGAGCAGG - Intergenic
1062931587 10:1356396-1356418 TGTGAAGCCCTCCAGGGGGTGGG - Intronic
1063871973 10:10427317-10427339 TTTGTCCTCCTCCAAGGTGCTGG + Intergenic
1067066106 10:43105162-43105184 CTTGAACTCCACCACGGCGCTGG - Exonic
1070553943 10:77513959-77513981 CCTGCACTCCTCCAGCGGGCGGG + Intronic
1073048208 10:100652396-100652418 TTTGATGTCCTCCAGGAGGTGGG + Intergenic
1075559640 10:123459214-123459236 TTTGAGCACCTCTATGGGGCTGG - Intergenic
1075574018 10:123565572-123565594 TTTGAACAACTCCAGGGTGAGGG - Intergenic
1076074598 10:127523180-127523202 TTAGAGCTCCTCCAGGGCGAGGG + Intergenic
1080341292 11:31268376-31268398 TGTGAACTCCTACAGCGGGAGGG - Intronic
1080521600 11:33072176-33072198 TTTGAGCTTCTCCTGGGAGCTGG + Intronic
1081699165 11:45141900-45141922 TTTCAGCTTCTCCAGTGGGCAGG + Intronic
1081739588 11:45429092-45429114 CTTGAACTCCTCCAGGGACAAGG - Intergenic
1081935129 11:46898989-46899011 CTGGAACTCCTCCAGGTTGCAGG + Exonic
1084357999 11:68652279-68652301 TTTGAGCCCCTCCAGGGAGATGG + Intergenic
1084710235 11:70839644-70839666 TTTGAGTACCTCCAGGAGGCTGG + Intronic
1085517039 11:77117636-77117658 TGTGAACGCCTCCAGGGAGCTGG - Intronic
1089392850 11:118113819-118113841 TTTGCTCTCCTCCAGGGGCAGGG + Intronic
1089613000 11:119679974-119679996 TGTGAACTCCTCCAAGGGCAGGG + Intronic
1091701387 12:2665654-2665676 TTTAAACTCATCCAGGTGGTGGG - Exonic
1092048403 12:5449890-5449912 TTTCTTCTCCTCCAGGAGGCAGG + Intronic
1094526171 12:31232634-31232656 TTTAAAATCTTCCAGGAGGCTGG + Intergenic
1094820252 12:34219042-34219064 TTTGACCTCCTTCAGGGGCTGGG - Intergenic
1095094490 12:38138442-38138464 TGGGAACTCCTCCAGGGGCTGGG + Intergenic
1095982024 12:47979378-47979400 TAGCTACTCCTCCAGGGGGCAGG + Intronic
1097187678 12:57204416-57204438 CTGGAACTCGTCCAGGGGGCAGG - Exonic
1098165788 12:67696140-67696162 TTTGAACACCTCAAGGAGGAAGG + Intergenic
1101745514 12:107538530-107538552 TTTGAGCTCTGCCAGGGGCCAGG + Intronic
1105303719 13:19155339-19155361 TTTCAACTCCTCCAGGCGGCTGG + Intergenic
1105811805 13:24001981-24002003 ATTGAAGTCACCCAGGGGGCGGG + Intronic
1105927586 13:25021192-25021214 ATTGAACTCACCCAGGGGGCAGG + Intergenic
1106698521 13:32204441-32204463 TTAGAACTCAGCCAAGGGGCAGG + Intronic
1112516337 13:100056262-100056284 TCTGAACTCCTTCAGGTGCCAGG + Intergenic
1113572052 13:111365221-111365243 TTTGCTCTCCTCCTGGAGGCAGG + Intergenic
1113740390 13:112708823-112708845 TTTGAACTCATGGAGGGGGAGGG + Intronic
1113913484 13:113855932-113855954 CTTGGACTCCTCCAGTGGCCGGG + Intronic
1116589647 14:46755328-46755350 TTTACAATCCTCCAAGGGGCAGG + Intergenic
1121123620 14:91392196-91392218 TTTGAACTCCTCCTAGGTACAGG - Intronic
1122417693 14:101558192-101558214 TTACAACTCCAGCAGGGGGCGGG - Intergenic
1128351599 15:66894460-66894482 TTTGATCTACTCCAGGTGGGGGG + Intergenic
1129179831 15:73867084-73867106 TGGGACCTCCTCTAGGGGGCAGG - Intergenic
1130057927 15:80544985-80545007 CTTGAACTCCTCCAGTGGTGGGG - Intronic
1130652271 15:85768809-85768831 GCTGAACTCCTTCCGGGGGCTGG + Exonic
1130891862 15:88140115-88140137 TTGGAATTCATCCAGGAGGCAGG + Intronic
1131847276 15:96501295-96501317 TTTGATCCACTCCTGGGGGCTGG + Intergenic
1133102489 16:3487785-3487807 TTTGACCTCATCCAGTGGCCGGG + Intergenic
1134840085 16:17394780-17394802 TTTCAACTCCTCTAAGGGGTAGG - Intronic
1136685799 16:31994334-31994356 TTTGAACTCCTCCAGTTCGGGGG - Intergenic
1136786412 16:32937867-32937889 TTTGAACTCCTCCAGTTCGGGGG - Intergenic
1136883360 16:33915928-33915950 TTTGAACTCCTCCAGTTCGGGGG + Intergenic
1138768293 16:59631209-59631231 TTGTAACTCCTCCAGAAGGCAGG + Intergenic
1203088646 16_KI270728v1_random:1199533-1199555 TTTGAACTCCTCCAGTTCGGGGG - Intergenic
1142719532 17:1766978-1767000 ACTGACCTCCTCCGGGGGGCTGG - Exonic
1143852044 17:9820376-9820398 TTGGAAATCCTCCAGGATGCAGG + Intronic
1146681997 17:34815183-34815205 TCTCAGCTCCTCCAGGGTGCAGG - Intergenic
1147146751 17:38489992-38490014 TTTGAACTCCTCCAGTTCGGGGG - Intronic
1150358064 17:64505552-64505574 TTTGAGCTCCTCCGCCGGGCGGG + Intronic
1151166621 17:72209395-72209417 TCTGATTTCCTCCAGGGTGCTGG + Intergenic
1155982543 18:32196242-32196264 TTTGAACTGCTCCAAGACGCTGG + Intronic
1161913652 19:7213047-7213069 TTTAAACCACTACAGGGGGCCGG + Intronic
1162236030 19:9310101-9310123 TTTTAAATACTCCAAGGGGCGGG + Intergenic
1162672269 19:12266939-12266961 CTTGATGTCCTCCAGGGGTCAGG + Intronic
1163099823 19:15088082-15088104 TCTGAACTCCTCCAGGGTAGGGG - Exonic
1163767910 19:19173510-19173532 TTAGCACTGATCCAGGGGGCGGG + Intronic
1164408636 19:27977414-27977436 TCTGAACCCATCCAGGGGCCGGG + Intergenic
1164463668 19:28469819-28469841 TTTGCACACCTTCAGGGGCCAGG + Intergenic
1165121784 19:33564427-33564449 ATTGATCTCCTCCATGGGTCAGG + Intergenic
1165384449 19:35502175-35502197 TTTGAAATCCTGCAGGGAGAAGG + Exonic
1167166904 19:47804668-47804690 ATTCAACTCCTCCAGGGGGCGGG - Intronic
1167174934 19:47859096-47859118 ATTCAACTCCTCCAGGGGGCGGG + Intergenic
927654683 2:24935332-24935354 TTACCAATCCTCCAGGGGGCAGG + Intergenic
929089542 2:38201397-38201419 TTTGTACTGCTCCAGAGGTCTGG + Intergenic
929539927 2:42811355-42811377 TCAGAAGTCCTCCCGGGGGCCGG + Intergenic
929560667 2:42954447-42954469 TTTGAATTCATCTAGGGGGCTGG + Intergenic
933666834 2:84971215-84971237 GCTGAGCTCCTCCAGGAGGCGGG - Exonic
936931534 2:117794841-117794863 CTTGAAATTCTCCAAGGGGCGGG - Intergenic
937400315 2:121577085-121577107 TTTAAAATTCTCCAGGGGACTGG + Intronic
937412591 2:121689496-121689518 TTCCAGCTCCACCAGGGGGCAGG - Intergenic
938292437 2:130157253-130157275 TTTGAACTCCTCCAGGGGGCTGG + Exonic
938464117 2:131515723-131515745 TTTGAACTCCTCCAGGGGGCTGG - Intergenic
941008245 2:160269645-160269667 CTTGAACACCTCCAGGGACCAGG - Intronic
942336830 2:174897573-174897595 TTTGATCTACTACAGGAGGCGGG - Intronic
946363721 2:219235693-219235715 TTTGAAATCCTCCAGGTGCCAGG + Exonic
946390833 2:219416187-219416209 TTCCTACTCCCCCAGGGGGCAGG + Intergenic
946525957 2:220520706-220520728 TTTGTACTTCTCCAGTGGCCAGG + Intergenic
947042282 2:225936906-225936928 TTTGAGCACCTGCAAGGGGCTGG - Intergenic
947233220 2:227910385-227910407 CTTGAACTCCTCCTGGGCTCAGG - Intronic
947470560 2:230397638-230397660 CTTGCACAACTCCAGGGGGCAGG + Intronic
947572344 2:231246020-231246042 TTGGGACTCATCCAGGGGGCAGG - Intronic
948060330 2:235038759-235038781 TATGACCTGCTTCAGGGGGCAGG + Intronic
1174083265 20:47985691-47985713 TCTGGGCTCCTCCAGTGGGCGGG + Intergenic
1174176423 20:48648201-48648223 TTTTAAATACTCCAGTGGGCTGG - Intronic
1175159140 20:56995139-56995161 TCTGGCCTCCTCCAGGGGGTTGG + Intergenic
1176871173 21:14084310-14084332 TGGGAACTCCTCCAGGGGCTGGG - Intergenic
1177558966 21:22726447-22726469 TTTGTAACCCTGCAGGGGGCTGG - Intergenic
1181111942 22:20607413-20607435 TTTGAACTCCCCCAGCGGGCTGG + Intergenic
1183942829 22:41305763-41305785 TCTAAGCTCCTCCAGGGTGCTGG - Intronic
1184459327 22:44628223-44628245 TCTAAACTCCTCCCAGGGGCTGG + Intergenic
949279052 3:2324758-2324780 TAGGCACTTCTCCAGGGGGCTGG + Intronic
950602347 3:14045865-14045887 GTTGAAGTCTTCCTGGGGGCGGG + Intronic
952652929 3:35747666-35747688 TTTGTACTCCTCCAAGTTGCTGG - Intronic
954609933 3:51939032-51939054 TTTGACCTGCTCCTGGGAGCTGG + Intronic
959499816 3:107093208-107093230 TTTGAACTCATCCAGTGTGGGGG + Intergenic
961613605 3:128161164-128161186 TCTGAACCACTACAGGGGGCTGG - Intronic
962289682 3:134123590-134123612 CTTGAACTCCGCCTGAGGGCAGG + Intronic
964350817 3:155802044-155802066 ATTAAACAACTCCAGGGGGCGGG - Intronic
967270837 3:187730931-187730953 TTTGAAAACCTCCAGGAGCCAGG - Intronic
969558148 4:7927470-7927492 GTTGAACTCCTCCATGTGCCGGG - Intronic
969655647 4:8496483-8496505 GTTGAGCTCCTGCATGGGGCGGG - Intergenic
969929024 4:10612227-10612249 ATTGAACTCTTCCTGTGGGCGGG - Intronic
973156557 4:46962159-46962181 TTAGAACTACCCCATGGGGCAGG - Intronic
976147692 4:82058320-82058342 TTTGAACTGCTCCAGGGGTGGGG - Intergenic
977194277 4:94039882-94039904 TTTGAACTACTGCAAGGTGCAGG + Intergenic
978557013 4:109991854-109991876 TTAGAACACCTGCATGGGGCTGG + Intronic
981136805 4:141220225-141220247 TTTTATCTCCTGCAGGGGGAGGG + Intergenic
983772948 4:171572954-171572976 TTTGACCTCCTCCAGTGAGGCGG - Intergenic
984951961 4:185014672-185014694 TGTGAACTCCTCCAGGGCTGAGG - Intergenic
987146859 5:14999938-14999960 TTTGACCTCTTCCAGGGGGAGGG + Intergenic
996783394 5:127212939-127212961 TTTGAACTCCACCAGAGGCATGG + Intergenic
997446351 5:133943141-133943163 TCTGAACTCCTCACGGAGGCTGG + Intergenic
1002370090 5:178745108-178745130 TTTGAACTCCACCAGAGGCATGG - Intergenic
1004146297 6:13070019-13070041 TTTGAAGTTCTGCAGAGGGCTGG - Intronic
1013245400 6:108282594-108282616 TTTAAGATCCTCAAGGGGGCTGG - Intergenic
1013633464 6:112007402-112007424 TTTGAGCTCCTCCAGGGCCCAGG + Intergenic
1015843107 6:137493736-137493758 CTTCATCTCCTCCAGGGAGCTGG + Exonic
1015979888 6:138827852-138827874 TTTAAAATAATCCAGGGGGCTGG - Intronic
1016862003 6:148730401-148730423 TTTAAATTCTTCCAGGAGGCTGG - Intergenic
1022639788 7:32170960-32170982 TTTGAATGACTTCAGGGGGCTGG - Intronic
1023814721 7:43941004-43941026 TTTGAACACCTCTAGGGGCTTGG + Intronic
1024533496 7:50411419-50411441 AAAGAACTCCTCCAGGGGACAGG + Intergenic
1031773555 7:125877443-125877465 TTGGAACTCCCCCAGTGGGCTGG - Intergenic
1032083653 7:128872672-128872694 CTTGAACTCCTGTAGGGGGCAGG - Intronic
1035627273 8:1080299-1080321 TGTGCTCTCCTCCGGGGGGCCGG + Intergenic
1036759366 8:11496726-11496748 TCTGTACTCCCCCAGGGGCCTGG - Intronic
1037270961 8:17130086-17130108 TTTTAACTCTTCCAGTGTGCAGG - Intergenic
1041993972 8:64030044-64030066 TTTGACTTCCTCCAGGGGCCAGG - Intergenic
1045261777 8:100581849-100581871 TTTGAACTCATCCTGAGTGCTGG - Intronic
1046544024 8:115624232-115624254 TTTGAACTTTTCCAGGGGTAAGG - Intronic
1047507078 8:125488433-125488455 TTTGGACACCTCCAGAGGCCAGG - Intergenic
1047507088 8:125488487-125488509 TTTGGACACCTCCAGAGGCCAGG - Intergenic
1049297940 8:141853172-141853194 TCTCACCTCCTCCAGGGTGCTGG - Intergenic
1049548904 8:143247252-143247274 TTTGAGCACCTCCCGGGCGCCGG + Exonic
1049983369 9:925154-925176 TTCGTACTCCTCCAGGTGCCTGG + Intronic
1051131078 9:13861647-13861669 TTTTAACTCCTACAGGGTCCTGG - Intergenic
1060312228 9:122472392-122472414 TTTCAACTAGTCCAGAGGGCTGG - Intergenic
1060864991 9:126988566-126988588 TTTAAAATCCTTCAGAGGGCTGG - Intronic
1061975503 9:134066430-134066452 TCTGAACCCCTGCAAGGGGCTGG - Intronic
1062433636 9:136536530-136536552 TTTGGACACATCCATGGGGCGGG - Intronic
1062587223 9:137254850-137254872 TCTGAGCGCCTTCAGGGGGCCGG - Intergenic
1187391893 X:18891530-18891552 TTTGAAATGATCCACGGGGCAGG + Intergenic
1187520978 X:20013800-20013822 TTTGACCTTGTCCATGGGGCCGG - Intronic
1187708038 X:22026723-22026745 TTTGAACTCCTCCAGTCTGAAGG + Intergenic
1189201058 X:39195904-39195926 TTTAAACTCCTCCTGGGTGCTGG - Intergenic
1195173558 X:102293140-102293162 TGTGGACTACTCGAGGGGGCAGG - Intergenic
1195185307 X:102393956-102393978 TGTGGACTACTCGAGGGGGCAGG + Intronic
1200302761 X:154995026-154995048 TCTGTACTCCTCTATGGGGCTGG - Intronic