ID: 938292560

View in Genome Browser
Species Human (GRCh38)
Location 2:130157797-130157819
Sequence GACCCTGGATCCAGAGCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938292560_938292570 28 Left 938292560 2:130157797-130157819 CCACAAGCTCTGGATCCAGGGTC No data
Right 938292570 2:130157848-130157870 AAGCACATGGAACCCAGGTGTGG No data
938292560_938292568 15 Left 938292560 2:130157797-130157819 CCACAAGCTCTGGATCCAGGGTC No data
Right 938292568 2:130157835-130157857 AAGTGTGTGCAGAAAGCACATGG No data
938292560_938292569 23 Left 938292560 2:130157797-130157819 CCACAAGCTCTGGATCCAGGGTC No data
Right 938292569 2:130157843-130157865 GCAGAAAGCACATGGAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938292560 Original CRISPR GACCCTGGATCCAGAGCTTG TGG (reversed) Intronic
No off target data available for this crispr